Entry information : OsiAPx-R
Entry ID 7156
Creation 2010-01-13 (Marcel Zamocky)
Last sequence changes 2011-05-03 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-05-03 (Christophe Dunand)
Peroxidase information: OsiAPx-R
Name OsiAPx-R
Class Ascorbate peroxidase related    [Orthogroup: APx-R001]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa (indica cultivar-group)    [TaxId: 39946 ]
Cellular localisation Chloroplastic
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsiAPx-R
start..stop
S start..stop
OsAPx-R 676 0 1..331 1..331
ObrAPx-R 603 0 1..331 1..331
TaAPx-Ra 514 0 1..331 1..333
BdiAPx-R 508 0 1..331 1..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 27663041..27663114 74 N° 2 27662832..27662947 116 N° 3 27662643..27662733 91 N° 4 27662226..27662353 128
N° 5 27661965..27662035 71 N° 6 27661805..27661847 43 N° 7 27661613..27661709 97 N° 8 27661343..27661426 84
N° 9 27661015..27661136 122 N° 10 27660772..27660838 67 N° 11 27660412..27660514 103  
complement(join(27660412..27660514,27660772..27660838,27661015..27661136,2766134 3..27661426,27661613..27661709,27661805..27661847,27661965..27662035,27662226..2 7662353,27662643..27662733,27662832..27662947,27663041..27663114))


exon

Literature and cross-references OsiAPx-R
Literature Yu J, Wang J, Lin W, Li H et al. "The genomes of Oryza sativa: a history of duplications" PLoS Biol. 3:266-281 (2005)
Protein ref. UniProtKB:   A2YX67
Protein sequence: OsiAPx-R
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331
PWM (Da):   %s   35522.9  
PI (pH):   %s   7.36
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MELNNVPHIAASSRFFSSCSRCTCRIRRSGKTRIGASAAGRRCSSDDSACSEPSEQQNADFFGPISSLCYTRRDFASVALLPFILPHVHIARAAEPIDGSIIQNGVRNVLSKVKAAGMLRLAFHDAGTFDIADKGGMNGSIIYEVDRPENTGLNKSIKVLGKAKEVIDLVQVSWADLIAVAGAESVALCGGPEIPVRLGRLDSSTADPAGKLPEETLDATALKTLFSKKGFSTQEMVVLSGAHTIGGKGFGNPNIFDNSYFKVLLEKPQPSSGMPAMVGLRTDWALTEDDECLRWINLYAQDQANFFADFKDAYIKLVNTGASWRSA

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCTCAATAATGTCCCCCATATTGCAGCCTCCTCCCGCTTCTTCTCCAGCTGCAGTCGTTGCACCTGCAGGTAATGTTTGCATCTTCTCTCATGCTTTGATACCAACCGTGCCATC
ATTTGTTCATGGAAGGCACATGACCTGTGAAAATTGTGATGATACAGGATTAGAAGAAGTGGGAAGACGAGGATAGGAGCTTCTGCTGCTGGTCGTAGGTGCAGTAGTGATGATTCTGCT
TGTTCAGAACCCTCTGAGCAGCAAAATGCAGATTTCTTTTCAG
GTATGAGTTGTTTCCATTGCAAGAACTGAGAGAATGCTTCCAGTGCCTACTGATATATTTCTGCCCAACTGAATTTG
CTTTGTGTATGGTGACCACAGGTCCCATATCTTCTCTTTGTTATACAAGGAGGGACTTTGCTTCTGTTGCTCTGCTCCCTTTCATACTTCCTCATGTTCATATAGCGAGGGCGTAAGTGC
AGTATTCAACCACAATCATATTCCTATTCTGCTCTAAGTTTCCATAGCTATGAGTTGCTAACCGTATTAATTTACATTTCTATGAGTATTTTTATTTATGTTTAATTGGTTCAATTGTGG
AAGCATGGCCTAGAATCAAAAGTCGAAATGAACCACAGGTCAATAAAGTATACCTACAATAGCTATTTGTGTATAAGAATAACCTACTCAAAGTAGTTTCATTCTCGTAAAACAGCAGTA
TGACATCTTTTAGAGAAGTTTTTTTATGTTTGACTCTATAGGGCTGAGCCAATTGATGGTTCAATTATTCAAAACGGTGTGAGGAATGTTTTATCCAAGGTCAAGGCTGCTGGCATGCTT
CGTTTGGCTTTCCATGATGCAGGGACTTTTGATATTGCTGATAAATCAG
GTTCGATCTTTAATGTCTTCATTGGTTGAAGTTCTATATACAGTTTTAGAGCAAAAATTGAATGTGTATAA
AGTAGAATTATAGAGTATTGCAAACAAGAACAAACTATGAATAACTACACTTCAACCTATCTAAAGATGAATTCTGAGAAGTAAAACAGTAGATGGATATTTATGACAATATCTTGCAGG
TGGCATGAATGGATCTATAATTTATGAAGTTGATAGACCTGAAAATACTGGGCTAAATAAATCCATAAAG
GTTTTTTTCCTCCTTTTTTTTCTTGCTTTTTATCATAAATAGTAGTAACA
TATCCTTACTGAAGAACAACATGTTTTGACTTCCCATATCTGTTTTTAATGACTTATAACTGAACAGGTATTAGGAAAAGCGAAAGAAGTAATTGACCTTGTGCAGCAAGGTACATGGTT
TACACCCTTTTTATATGTTCTTTCTGTTTTGAGCTTCGGTTGTGATGTATCTTCAAGCACACATATACCGTTACTTTGCTAACAGTATCATGGGCGGATTTGATTGCCGTGGCTGGTGCT
GAGTCAGTTGCGCTATGTGGAGGGCCAGAAATTCCAGTAAGACTAGGTCGATTAGATTCCAG
GTGCAACATCACAGTGGTTTGTTCATTTAACAGTTCCCTTGCAATGTTGGCAAAATTT
TAGGCTGTTCATTTCCAGGCAGTGCTTCTATTTAGTATGCATCCATATTTTTTAAAGAACATGTAGGTATCCATATTTTCTCAAAGTAATATCCATATTCTTATGAAATAATGCATTTGA
CTCTGTAGTACTGCTGATCCTGCTGGTAAACTTCCTGAAGAAACATTGGATGCCACTGCGCTGAAAACATTATTCAGCAAAAAGGGCTTTTCGTGAGTCCTCCTTTTCTCTACTTACACA
AACATCTTGTGAATTCAATTCCCATTGCCTATTTATGAAAATTTACTAATGCGTGGTTAAAAATTATGTATCTGTACATGATACGTATCTGCACATGATTTCCCCTCTAGGCTTCTACAA
AATGTTCCTGAAAACTTAGCATCCTTCCATGTCTGAAGTTAAACTTGATACTTGGCAGGACACAGGAGATGGTTGTGTTATCTGGAGCACACACAATTGGAGGTAAAGGATTCGGGAATC
CAAATATTTTCGACAACTCCTATTTTAAAGTACTCCTTGAGAAGCCACAGCCATCTTCAT
GTAAGTCCATTCATTTTTTCCATCATGCCCTTTAAATACTGTCATCATGAATCCATAAGC
CATAACTGAATCTCAACTTAGCTCATGCCTTTGTAAATCATCCTTGTACAATGTACAATCGACTTGGCATTATTTGTAAATCACCTTAATACAATGTGTTGTGTTCTTCTATGAAGCTGG
CATGCCGGCAATGGTAGGACTGCGAACGGATTGGGCACTCACTGAAGATGATGAATGCTTAAG
GTATTTTTTTTCTTGAACTAGATATGCTAAATAATGTCGCTTACTTGTTACAAGCTC
TGAAGAAGTACTAGGGATAATCATAAGCTTCCAAACTCCATGCACTAATCCTACTCTATCTTCAATTCTTTCAGTCAGGACCTAGGCTTTAGGTTTTAAGTCACAAATTTATAGGACAAA
TAGATATATTTGCAAGGTTCCTTCATGCTCACATGTTTGGTCAGGCCATTGACATTGGGCATATGCCAAACTACTTGCAGATGGATCAATTTATATGCACAGGACCAAGCTAATTTTTTT
GCCGACTTCAAGGATGCATACATCAAGCTTGTAAATACTGGAGCCTCATGGAGATCAGCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCTCAATAATGTCCCCCATATTGCAGCCTCCTCCCGCTTCTTCTCCAGCTGCAGTCGTTGCACCTGCAGGATTAGAAGAAGTGGGAAGACGAGGATAGGAGCTTCTGCTGCTGGT
CGTAGGTGCAGTAGTGATGATTCTGCTTGTTCAGAACCCTCTGAGCAGCAAAATGCAGATTTCTTTTCAG
GTCCCATATCTTCTCTTTGTTATACAAGGAGGGACTTTGCTTCTGTTGCT
CTGCTCCCTTTCATACTTCCTCATGTTCATATAGCGAGGGC
GGCTGAGCCAATTGATGGTTCAATTATTCAAAACGGTGTGAGGAATGTTTTATCCAAGGTCAAGGCTGCTGGCATGCTT
CGTTTGGCTTTCCATGATGCAGGGACTTTTGATATTGCTGATAAATCAG
GTGGCATGAATGGATCTATAATTTATGAAGTTGATAGACCTGAAAATACTGGGCTAAATAAATCCATAAAG
GTATTAGGAAAAGCGAAAGAAGTAATTGACCTTGTGCAGCAAGTATCATGGGCGGATTTGATTGCCGTGGCTGGTGCTGAGTCAGTTGCGCTATGTGGAGGGCCAGAAATTCCAGTAAGA
CTAGGTCGATTAGATTCCAG
TACTGCTGATCCTGCTGGTAAACTTCCTGAAGAAACATTGGATGCCACTGCGCTGAAAACATTATTCAGCAAAAAGGGCTTTTCGACACAGGAGATGGTT
GTGTTATCTGGAGCACACACAATTGGAGGTAAAGGATTCGGGAATCCAAATATTTTCGACAACTCCTATTTTAAAGTACTCCTTGAGAAGCCACAGCCATCTTCAT
CTGGCATGCCGGCA
ATGGTAGGACTGCGAACGGATTGGGCACTCACTGAAGATGATGAATGCTTAAG
ATGGATCAATTTATATGCACAGGACCAAGCTAATTTTTTTGCCGACTTCAAGGATGCATACATCAAG
CTTGTAAATACTGGAGCCTCATGGAGATCAGCTTAA

Retrieve as FASTA