Entry information : PtritAPx-CcP01
Entry ID 7157
Creation 2010-01-13 (Marcel Zamocky)
Last sequence changes 2010-01-13 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-10-26 (Christophe Dunand)
Peroxidase information: PtritAPx-CcP01
Name PtritAPx-CcP01
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Pyrenophora
Organism Pyrenophora tritici-repentis    [TaxId: 45151 ]
Cellular localisation Secreted
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtritAPx-CcP01
start..stop
S start..stop
PterAPx-CcP01 929 0 1..526 1..527
ClunAPx-CcP01 791 0 1..526 1..529
COsaAPx-CcP01 775 0 1..526 1..530
CheAPx-CcP01_C4 770 0 1..526 1..530
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 808230..808614 385 N° 2 806964..808159 1196  
complement(join(806964..808159,808230..808614))


exon

Literature and cross-references PtritAPx-CcP01
Literature Birren B.W., et al., Genome sequence of Pyrenophora tritici-repentis.
Protein ref. UniProtKB:   B2WHP0
DNA ref. JGI genome:   supercontig_1.11 (808614..806964)
Protein sequence: PtritAPx-CcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   526 (507)
PWM (Da):   %s   55269.36 (53172.2)  
PI (pH):   %s   4.52 (4.52) Peptide Signal:   %s   cut: 20 range:20-526
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MYTTLPLLLALSIFYTNAALYHPTIQISLLEHILVDNWGAYASNFSSAIAPCDRYVTQTGTAALTSGRTTAAQWIRVMFHDFITANVSAGTDGLDASIGFETAREENKGSAFNDSFTFWRPFVNGAVSMADLIALGTVMSNNLCGGAQMPYRAGRIDAASAGITTGVPAPETSLEETLTFFDRAGFNAQDAIGLTACGHTMGSVHHGGFPDVVDDSFVTPNNTNGGSNFDTSRAVFDAKVVGEYVHWTGKKGGPLVTSYNDSMKSDLRLYESDGNATMRALLEKGDGFLDACVELMRRAIDTVPGGVRLGEEIAALAVKPVNVTFDFDGQGKLVLSGRIRVLNKAGEERPRSLRLGSGEDEVGVEITAEAETGQSVFGRGSGGYGVTTYFPFSLTGPSTRNATSFSVSGAGVQQTFSVSSQSFVVPSLTSLQRISLNATVAIPTSSSCDDLTVRVAAPFSQPGTLAPKMSEEHISMAEATNKADGYKLCAGTELLDQLPTGLLIVEASIGETIVDSLLVDGGMAGW

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron). No EST available. Secreted, signal peptide N-terminal 18 amino acids with high probability.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTACACTACCCTCCCTCTCCTCCTCGCCTTATCCATCTTCTACACAAATGCAGCCCTCTACCACCCCACCATTCAAATCTCTCTCCTCGAACACATCCTCGTCGATAACTGGGGCGCC
TACGCCTCAAACTTCTCCTCTGCAATCGCACCCTGCGACCGCTATGTAACGCAAACCGGAACCGCAGCTCTAACCAGCGGCCGCACAACAGCTGCACAATGGATACGCGTCATGTTCCAC
GATTTCATCACCGCTAACGTGAGCGCTGGAACAGATGGTTTGGATGCGAGTATAGGATTTGAGACGGCGCGGGAGGAAAACAAGGGCAGTGCGTTTAACGACAGTTTTACGTTTTGGAGA
CCGTTTGTTAATGGGGCTGTATCAA
GTATGTGACCTCCTCTCCAATAAAGCATGTTCTAGTATACGAAGTGATGTACACTTACACAAACATTCAGTGGCCGATCTCATAGCCCTCGGAAC
AGTAATGTCAAACAACCTCTGCGGCGGAGCACAAATGCCGTACCGCGCCGGTCGCATCGATGCCGCCTCCGCAGGTATCACAACCGGTGTGCCCGCCCCAGAAACCTCGCTCGAGGAAAC
TCTCACCTTCTTCGACCGCGCGGGCTTCAACGCCCAAGACGCCATTGGCCTCACAGCTTGCGGTCACACAATGGGTTCTGTACACCACGGCGGCTTCCCGGACGTCGTAGATGACTCATT
CGTGACGCCGAATAACACAAACGGCGGCAGTAACTTTGACACCTCACGCGCTGTGTTCGATGCAAAAGTCGTAGGCGAATATGTGCATTGGACGGGGAAAAAAGGCGGGCCCTTAGTTAC
GTCGTATAACGATAGTATGAAGTCTGATCTCCGGTTGTATGAGAGCGATGGTAACGCTACTATGCGCGCGTTGTTGGAGAAAGGAGATGGGTTTTTGGATGCGTGTGTGGAGCTTATGCG
GAGGGCGATTGATACGGTGCCTGGTGGTGTGCGACTTGGTGAAGAGATTGCGGCTCTGGCGGTTAAGCCGGTTAATGTGACGTTTGACTTTGATGGGCAGGGGAAGTTGGTGCTTTCGGG
GAGGATTAGAGTGCTGAATAAGGCGGGAGAGGAGAGGCCGAGATCACTTCGGCTTGGTTCAGGCGAGGATGAGGTTGGTGTGGAAATTACTGCTGAAGCAGAGACTGGTCAGTCTGTATT
TGGGAGAGGGAGTGGTGGGTATGGAGTTACAACTTATTTCCCCTTTTCGCTCACTGGGCCATCCACAAGGAATGCTACTTCCTTCTCTGTGAGCGGCGCGGGCGTACAGCAAACGTTTTC
TGTCAGCAGCCAGAGTTTCGTTGTACCAAGCCTGACCTCTCTGCAGAGGATATCACTCAACGCTACGGTTGCGATACCGACGTCGAGCTCCTGCGACGATTTGACGGTACGTGTTGCAGC
ACCCTTTTCGCAACCAGGAACCTTGGCGCCGAAGATGAGCGAGGAGCATATTTCGATGGCCGAAGCTACGAACAAGGCCGACGGGTATAAGCTTTGTGCGGGTACCGAACTCTTGGATCA
GTTGCCAACCGGCTTGCTCATCGTTGAAGCTTCAATAGGAGAAACGATTGTTGATTCACTGTTAGTCGATGGAGGCATGGCAGGATGGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTACACTACCCTCCCTCTCCTCCTCGCCTTATCCATCTTCTACACAAATGCAGCCCTCTACCACCCCACCATTCAAATCTCTCTCCTCGAACACATCCTCGTCGATAACTGGGGCGCC
TACGCCTCAAACTTCTCCTCTGCAATCGCACCCTGCGACCGCTATGTAACGCAAACCGGAACCGCAGCTCTAACCAGCGGCCGCACAACAGCTGCACAATGGATACGCGTCATGTTCCAC
GATTTCATCACCGCTAACGTGAGCGCTGGAACAGATGGTTTGGATGCGAGTATAGGATTTGAGACGGCGCGGGAGGAAAACAAGGGCAGTGCGTTTAACGACAGTTTTACGTTTTGGAGA
CCGTTTGTTAATGGGGCTGTATCAA
TGGCCGATCTCATAGCCCTCGGAACAGTAATGTCAAACAACCTCTGCGGCGGAGCACAAATGCCGTACCGCGCCGGTCGCATCGATGCCGCCTCC
GCAGGTATCACAACCGGTGTGCCCGCCCCAGAAACCTCGCTCGAGGAAACTCTCACCTTCTTCGACCGCGCGGGCTTCAACGCCCAAGACGCCATTGGCCTCACAGCTTGCGGTCACACA
ATGGGTTCTGTACACCACGGCGGCTTCCCGGACGTCGTAGATGACTCATTCGTGACGCCGAATAACACAAACGGCGGCAGTAACTTTGACACCTCACGCGCTGTGTTCGATGCAAAAGTC
GTAGGCGAATATGTGCATTGGACGGGGAAAAAAGGCGGGCCCTTAGTTACGTCGTATAACGATAGTATGAAGTCTGATCTCCGGTTGTATGAGAGCGATGGTAACGCTACTATGCGCGCG
TTGTTGGAGAAAGGAGATGGGTTTTTGGATGCGTGTGTGGAGCTTATGCGGAGGGCGATTGATACGGTGCCTGGTGGTGTGCGACTTGGTGAAGAGATTGCGGCTCTGGCGGTTAAGCCG
GTTAATGTGACGTTTGACTTTGATGGGCAGGGGAAGTTGGTGCTTTCGGGGAGGATTAGAGTGCTGAATAAGGCGGGAGAGGAGAGGCCGAGATCACTTCGGCTTGGTTCAGGCGAGGAT
GAGGTTGGTGTGGAAATTACTGCTGAAGCAGAGACTGGTCAGTCTGTATTTGGGAGAGGGAGTGGTGGGTATGGAGTTACAACTTATTTCCCCTTTTCGCTCACTGGGCCATCCACAAGG
AATGCTACTTCCTTCTCTGTGAGCGGCGCGGGCGTACAGCAAACGTTTTCTGTCAGCAGCCAGAGTTTCGTTGTACCAAGCCTGACCTCTCTGCAGAGGATATCACTCAACGCTACGGTT
GCGATACCGACGTCGAGCTCCTGCGACGATTTGACGGTACGTGTTGCAGCACCCTTTTCGCAACCAGGAACCTTGGCGCCGAAGATGAGCGAGGAGCATATTTCGATGGCCGAAGCTACG
AACAAGGCCGACGGGTATAAGCTTTGTGCGGGTACCGAACTCTTGGATCAGTTGCCAACCGGCTTGCTCATCGTTGAAGCTTCAATAGGAGAAACGATTGTTGATTCACTGTTAGTCGAT
GGAGGCATGGCAGGATGGTAA

Retrieve as FASTA