Entry information : GmRboh11 ( Glyma07g15690)
Entry ID 7185
Creation 2010-02-03 (Christophe Dunand)
Last sequence changes 2016-04-06 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-04-06 (Achraf Jemmat)
Peroxidase information: GmRboh11 ( Glyma07g15690)
Name (synonym) GmRboh11 ( Glyma07g15690)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmRboh11
start..stop
S start..stop
GmRboh14 1494 0 1..859 1..860
MtRboh09 1371 0 1..859 1..851
EgrRboh06 1233 0 10..859 3..857
EglRboh06 1231 0 10..859 3..857
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..400 400 N° 2 708..873 166 N° 3 960..1008 49 N° 4 1119..1232 114
N° 5 1325..2137 813 N° 6 2418..2513 96 N° 7 2587..2702 116 N° 8 2794..2896 103
N° 9 3013..3110 98 N° 10 3182..3347 166 N° 11 3622..3762 141 N° 12 3854..3982 129
N° 13 4076..4154 79 N° 14 4250..4359 110  
join(1..400,708..873,960..1008,1119..1232,1325..2137,2418..2513,2587..2702,2794. .2896,3013..3110,3182..3347,3622..3762,3854..3982,4076..4154,4250..4359)


exon

Literature and cross-references GmRboh11 ( Glyma07g15690)
DNA ref. GenBank:   NC_016094.2 (15510046..15514404)
Cluster/Prediction ref. Genebank:   100791701
Protein sequence: GmRboh11 ( Glyma07g15690)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   859
PWM (Da):   %s   98016.89 Transmb domain:   %s   o303-321i442-464o484-506i676-693o
PI (pH):   %s   9.43
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSQKGGKDESSTWILESIEIDPVVGRPKRDDEAPPNGSTVLKSPNDVAAVNNNNNNNNNNNNVRSRLGIRGSNGGRKMMRTESGAARGIKGLRFLDRTVTGRETDAWKSIEKRFTQNAVDGKLTKDKFGTCMGMGAESKDFAGELYEALARRRKVYAENGISLDEAKVFWEDMTNKDFESRLQVFFDMCDKNGDGKLSEDEVKVIVLSASANKLGNLKMHADGYASLIMEELDPDHNGYIEIWQLETLLKEMVSSEEGTKKLDQCRAMTLSKAMIPSKYRTPVSKFLSKTTEFALDKWKKIWVFALWLAINLVLFIWKFKQYREKKAFQVMGYCLCFAKGAAETLKFNMALIVLTMCRRTLTKLRGSFLSRIIPFDDNINFHKTIAVAVVIGTFIHVMMHITCDFPRLISCPENKFFSIFGDGFNYEQPTYYTLVKSIPGLTGILMVLIMAFTFTLATHYFRKSVVKLPSPLHRLAGFNAFWYAHHLLIVVYILLIIHGYFLFLTKEWNKKTTWMYLVVPLALYAFERIHPFFRSKDHRVSIIKAIIYTGNVLALYMTKPQGFKYESGMYLFVKCPDISTFEWHPFSITSAPGDDYLSVHIRTLGDWTTELKNTFAVCEPHNAQPRKGNLMRMETRAPNSTYNHPSKSRIRYPKILIKGPYGAPAQSYKNYDVLFLIGLGIGATPMISILKDMLNNMKSESPKDSVPSSNSDDQIKKGPERAYFYWVTREQSSFEWFKGVMDDIADYDCDNIIEMHNYLTSVYEEGDARSALIAMIQRLQHAKNGVDVVSESRIRTHFARPNWKKVFTELANAHQSSRIGVFYCGSPTLTKTLKELCHEFSLKSSTRFQFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 7, 13 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCATCACAAAAAGGAGGCAAAGATGAATCATCAACGTGGATTCTTGAGAGCATTGAGATTGATCCCGTTGTGGGAAGGCCTAAAAGGGATGATGAAGCACCCCCTAATGGAAGCACG
GTGCTTAAATCTCCCAATGATGTTGCTGCTGTGAACAACAACAACAACAACAACAACAACAACAACAATGTGAGGAGCAGACTTGGCATTCGGGGGAGTAATGGAGGGAGGAAAATGATG
AGGACTGAATCAGGAGCAGCCAGAGGGATTAAGGGTTTACGTTTTCTTGATAGAACGGTCACAGGGAGGGAAACTGATGCATGGAAGTCCATTGAGAAGCGCTTTACTCAGAATGCAGTT
GATGGAAAACTCACAAAAGACAAATTTGGAACCTGCATGG
GTACAAACATTTGCCTCCTTTTTGTTTTTATTGGGAATGCATTTGGACAAAAACTTAGATTTTCCTAGGTGCTTTTTTGG
TGGTGTTTTCCTGTCAGAATTAGAGTTTCGCCTTAGTAATTCATGTTAATAAAGGTTTACATTAAAGATCAACGTAGATTGTCGAAATAAAACTCCAATTCTGATTGGAGAACAACGCCG
CAAAAGTGTCTATGGAACTGTATCCAAGTTTTGTCGTTTTGTGATATATTTAGTTTTCATAATTAGTGGTAAGTTTGAATGATGCAAATTGAAATTGTGTTCCACAGGCATGGGGGCAGA
ATCAAAGGATTTTGCTGGGGAGCTGTATGAGGCTTTGGCAAGGAGAAGGAAAGTCTATGCAGAAAATGGGATATCTTTGGATGAAGCTAAAGTATTCTGGGAGGACATGACCAACAAAGA
TTTTGAATCTAGGCTTCAAGTGTTCTTTGACAT
GTAAAGCGCACACACACTATCTGTATTCCTTTTGCATGTTGCATTCTTATTGAATGGATTGGCATAAATGAATCAGTTATTTTCAGG
TGTGACAAGAATGGAGATGGTAAGCTATCAGAAGATGAGGTTAAGGAG
GTGAGTATTGAGACCACTTAAATTCTTCTGATTACCTTTTTTCTTTTCTTTTTTTTTCTCTCTCTCTTTCAT
TATATGGAAACAAAATTCTAAATGTCTTTGTTTAAAAGGTTATAGTGTTGAGCGCCTCAGCAAATAAGCTAGGAAACCTCAAAATGCATGCTGATGGGTATGCATCTTTGATAATGGAAG
AGCTTGACCCTGATCATAATGGATATATAGAG
GTTAGAAGTGAACAAGTTCTTACTGCTTTCTTCTTTTATTGAATTTTACATAAACCTTCATCTTTAGTATTCTTAAATTTCTTTTTAA
ACAGATCTGGCAGCTAGAAACTCTGCTGAAGGAAATGGTTAGTTCTGAAGAAGGCACCAAAAAACTTGATCAATGTAGAGCCATGACTTTGAGTAAAGCTATGATACCGAGCAAGTATAG
GACACCAGTGAGCAAATTTCTATCTAAAACCACAGAATTTGCTCTCGATAAATGGAAAAAAATATGGGTTTTCGCGCTTTGGTTGGCCATAAACTTGGTGCTTTTTATTTGGAAATTTAA
GCAATACAGGGAAAAGAAAGCCTTTCAAGTCATGGGTTACTGTCTCTGCTTTGCAAAGGGTGCTGCTGAGACTCTCAAGTTCAACATGGCTCTTATTGTCCTAACCATGTGCAGAAGAAC
ACTTACAAAACTAAGAGGATCATTTCTAAGTCGAATCATACCTTTTGATGACAATATAAACTTTCACAAGACGATTGCGGTAGCTGTGGTTATAGGGACTTTTATTCATGTAATGATGCA
TATCACTTGTGATTTTCCAAGATTAATATCATGCCCAGAAAATAAGTTCTTTTCGATATTTGGGGATGGTTTTAACTATGAGCAGCCTACTTACTACACCCTAGTTAAAAGCATTCCTGG
TTTAACTGGAATTCTTATGGTCTTGATTATGGCTTTTACCTTCACTCTAGCGACACATTATTTCAGAAAAAGTGTTGTCAAGTTGCCTTCCCCGTTGCATCGATTGGCTGGTTTCAATGC
ATTTTGGTATGCTCATCATTTGCTTATTGTGGTTTACATACTCCTGATCATACATGGCTACTTTCTATTTCTCACCAAGGAATGGAACAAGAAGACG
GTATGTGTAGCTCTAACACTTTT
CATCGCTCTAACTACCAACAAACCATACCTTCTAATTTCAATTTTCCAAAAGTTTTCTCTCAAAATGCAGTTACAACAGCTTTGCACTTTTAAACTGATATAAATTGTGGTTTATTTACG
TCTCATAACACATATAATTGAACTCTGTCCACCCTTCATTTGTTGATGTTGTACACTTGGTATTTTGACCTGATGGCTGATACTGCATGTCCAATTCTACATCATTGATTTGACATTAAT
ATCTTTGATTAATGCAGACTTGGATGTACCTTGTAGTTCCACTAGCACTCTATGCTTTTGAGAGAATTCACCCGTTTTTCAGGAGTAAAGATCACCGAGTAAGCATCATTAAGGTGTGTG
TCCACCACTTTTCCTTGATTCTTCAGGCTGGAGCACGGAAATGATTTTATCACTTGGAAATTTCAGGCAATAATATATACAGGAAATGTTCTGGCACTATACATGACCAAACCCCAAGGA
TTCAAGTATGAAAGTGGAATGTATCTTTTTGTCAAGTGTCCAGATATATCTACTTTTGAATG
GTAACAACCATGACTCTTGGATGATAGTGATCAAAGAAAAAAGATTTTTTTTGCAAAA
TCACTTTTAGGATCAAATTGAATCTTGTTGCAGGCATCCTTTCTCCATCACCTCTGCACCTGGAGATGACTACTTGAGTGTTCATATACGAACCTTGGGAGATTGGACTACAGAGCTTAA
AAACACATTTGCACAG
GTGATGTTAATGTCTGAACTGCGAACTCAATCAATCCTATGTATTTAGTAAGTCAAAGGTTCATATAAATATGGTAATTATTGAACATCTAGTTGTACTAATAC
TTAGAAATGCAGGTTTGTGAGCCTCACAATGCTCAACCAAGAAAGGGAAACCTTATGAGGATGGAAACTAGAGCACCAAATTCAACCTATAACCATCCTTCAAAATCAAGGTGAATAGCA
ACTCTTTGTTCTTAGCTTTACAAAATCATCTATAAATGTTGACATTATTTGGTCTTTCCAGAATTAGATATCCAAAGATCCTCATCAAAGGACCCTACGGAGCCCCAGCACAAAGCTATA
AGAACTATGATGTTCTCTTTCTCATAGGTCTCGGAATCGGTGCCACACCAATGATCAGTATTCTAAAAGATATGTTGAACAACATGAAGTCAGAAAGCCCTAAAGAG
GTAAGTGGCAGGT
TATATATACTTTTTTTGGTTGGCAGCATATCTGTATTTGAGTTTATTAGGTATTGTCCATGTAGAAGTTTTCACATTGCCCATCAAGTAGAAATCATCTTTAGTATGACTTTCAAGTAAT
TATTTTAAAAGTCAATAATCTTAAATTCTGACGATTTGTGATTGGATGACAATGCAATTAGCTTATGTATTATTTATTGTTTGTAGTTTATACGCTAAGTTCCAATTCAAGGGGTTAACA
TAGCAGGGAACCTATATGCAGGACTCAGTCCCTAGCAGTAACTCAGATGATCAAATTAAGAAAGGTCCTGAAAGAGCATATTTCTATTGGGTAACAAGAGAGCAGTCATCATTTGAATGG
TTTAAAGGTGTCATGGATGATATTGCAGATTATGACTGCGAT
GTGAGACTAAGGACCAAACACTTCATTTTTTTTTCCTGGTTTTGTTCCTTCCATGTACAGTAAAAAATGTTAGCATGT
TTGAATGATGCAGAATATCATAGAAATGCACAACTATTTGACAAGTGTCTACGAGGAAGGTGATGCAAGGTCCGCGCTTATTGCCATGATTCAGAGGCTGCAACATGCTAAAAATGGAGT
TGATGTTGTTTCAGAAAGCCGG
GTATTGATTGATTTACCACTCATTTAAACCAAAACCTTTTCACCATTCAACCAAATGTTAATCTTTTATTTTTTTTATCTTACCATATATCAGATTCG
AACACATTTTGCTAGACCAAACTGGAAAAAAGTCTTCACTGAATTAGCAAACGCGCATCAAAGCTCTCGGATAG
GTATACAAAGTTGCGATGCTTTGTGTGAAATTCTAAAAAACAAAAA
AGTTAATAAAAGAAATGAAAAAATTTTATCTGCTATTTTCTTGATGCAGGTGTATTCTACTGTGGAAGTCCTACTCTTACAAAAACACTGAAGGAACTTTGTCACGAGTTCAGCCTAAAG
TCATCTACCCGTTTTCAGTTTCACAAGGAGAACTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCATCACAAAAAGGAGGCAAAGATGAATCATCAACGTGGATTCTTGAGAGCATTGAGATTGATCCCGTTGTGGGAAGGCCTAAAAGGGATGATGAAGCACCCCCTAATGGAAGCACG
GTGCTTAAATCTCCCAATGATGTTGCTGCTGTGAACAACAACAACAACAACAACAACAACAACAACAATGTGAGGAGCAGACTTGGCATTCGGGGGAGTAATGGAGGGAGGAAAATGATG
AGGACTGAATCAGGAGCAGCCAGAGGGATTAAGGGTTTACGTTTTCTTGATAGAACGGTCACAGGGAGGGAAACTGATGCATGGAAGTCCATTGAGAAGCGCTTTACTCAGAATGCAGTT
GATGGAAAACTCACAAAAGACAAATTTGGAACCTGCATGG
GCATGGGGGCAGAATCAAAGGATTTTGCTGGGGAGCTGTATGAGGCTTTGGCAAGGAGAAGGAAAGTCTATGCAGAAAAT
GGGATATCTTTGGATGAAGCTAAAGTATTCTGGGAGGACATGACCAACAAAGATTTTGAATCTAGGCTTCAAGTGTTCTTTGACAT
GTGTGACAAGAATGGAGATGGTAAGCTATCAGAA
GATGAGGTTAAGGAG
GTTATAGTGTTGAGCGCCTCAGCAAATAAGCTAGGAAACCTCAAAATGCATGCTGATGGGTATGCATCTTTGATAATGGAAGAGCTTGACCCTGATCATAATGGA
TATATAGAG
ATCTGGCAGCTAGAAACTCTGCTGAAGGAAATGGTTAGTTCTGAAGAAGGCACCAAAAAACTTGATCAATGTAGAGCCATGACTTTGAGTAAAGCTATGATACCGAGCAAG
TATAGGACACCAGTGAGCAAATTTCTATCTAAAACCACAGAATTTGCTCTCGATAAATGGAAAAAAATATGGGTTTTCGCGCTTTGGTTGGCCATAAACTTGGTGCTTTTTATTTGGAAA
TTTAAGCAATACAGGGAAAAGAAAGCCTTTCAAGTCATGGGTTACTGTCTCTGCTTTGCAAAGGGTGCTGCTGAGACTCTCAAGTTCAACATGGCTCTTATTGTCCTAACCATGTGCAGA
AGAACACTTACAAAACTAAGAGGATCATTTCTAAGTCGAATCATACCTTTTGATGACAATATAAACTTTCACAAGACGATTGCGGTAGCTGTGGTTATAGGGACTTTTATTCATGTAATG
ATGCATATCACTTGTGATTTTCCAAGATTAATATCATGCCCAGAAAATAAGTTCTTTTCGATATTTGGGGATGGTTTTAACTATGAGCAGCCTACTTACTACACCCTAGTTAAAAGCATT
CCTGGTTTAACTGGAATTCTTATGGTCTTGATTATGGCTTTTACCTTCACTCTAGCGACACATTATTTCAGAAAAAGTGTTGTCAAGTTGCCTTCCCCGTTGCATCGATTGGCTGGTTTC
AATGCATTTTGGTATGCTCATCATTTGCTTATTGTGGTTTACATACTCCTGATCATACATGGCTACTTTCTATTTCTCACCAAGGAATGGAACAAGAAGACG
ACTTGGATGTACCTTGTA
GTTCCACTAGCACTCTATGCTTTTGAGAGAATTCACCCGTTTTTCAGGAGTAAAGATCACCGAGTAAGCATCATTAAG
GCAATAATATATACAGGAAATGTTCTGGCACTATACATGACC
AAACCCCAAGGATTCAAGTATGAAAGTGGAATGTATCTTTTTGTCAAGTGTCCAGATATATCTACTTTTGAATG
GCATCCTTTCTCCATCACCTCTGCACCTGGAGATGACTACTTGAGT
GTTCATATACGAACCTTGGGAGATTGGACTACAGAGCTTAAAAACACATTTGCACAG
GTTTGTGAGCCTCACAATGCTCAACCAAGAAAGGGAAACCTTATGAGGATGGAAACTAGAGCA
CCAAATTCAACCTATAACCATCCTTCAAAATCAAG
AATTAGATATCCAAAGATCCTCATCAAAGGACCCTACGGAGCCCCAGCACAAAGCTATAAGAACTATGATGTTCTCTTTCTCATA
GGTCTCGGAATCGGTGCCACACCAATGATCAGTATTCTAAAAGATATGTTGAACAACATGAAGTCAGAAAGCCCTAAAGAG
GACTCAGTCCCTAGCAGTAACTCAGATGATCAAATTAAG
AAAGGTCCTGAAAGAGCATATTTCTATTGGGTAACAAGAGAGCAGTCATCATTTGAATGGTTTAAAGGTGTCATGGATGATATTGCAGATTATGACTGCGAT
AATATCATAGAAATGCAC
AACTATTTGACAAGTGTCTACGAGGAAGGTGATGCAAGGTCCGCGCTTATTGCCATGATTCAGAGGCTGCAACATGCTAAAAATGGAGTTGATGTTGTTTCAGAAAGCCGG
ATTCGAACA
CATTTTGCTAGACCAAACTGGAAAAAAGTCTTCACTGAATTAGCAAACGCGCATCAAAGCTCTCGGATAG
GTGTATTCTACTGTGGAAGTCCTACTCTTACAAAAACACTGAAGGAACTT
TGTCACGAGTTCAGCCTAAAGTCATCTACCCGTTTTCAGTTTCACAAGGAGAACTTCTAA

Retrieve as FASTA