Entry information : ZmPrx23
Entry ID 719
Creation 2005-12-14 (Christophe Dunand)
Last sequence changes 2005-12-14 (Christophe Dunand)
Sequence status complete
Reviewer reviewer name not stored
Last annotation changes 2010-12-23 (Marie Brette (Scipio))
Peroxidase information: ZmPrx23
Name ZmPrx23
Class Class III peroxidase    [Orthogroup: Prx132]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue types Mixed tissues
Pollens
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx23
start..stop
S start..stop
SbPrx132 634 0 6..421 1..406
SiPrx42 558 0 36..421 18..372
OsPrx79 480 4e-170 29..362 24..357
BdiPrx29 471 9e-167 6..421 1..370
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 110782841..110783083 243 N° 2 110783166..110784188 1023  
join(110782841..110783083,110783166..110784188)


exon

Literature and cross-references ZmPrx23
Literature Walbot,V., unpublished
Protein ref. UniProtKB:   B4FKG0
DNA ref. GenBank:   AC197833.3 (28931..30275)
mRNA ref. GenBank:   BT037598
Protein sequence: ZmPrx23
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   421 (391)
PWM (Da):   %s   46691.39 (43551.8) Transmb domain:   %s   i13-32o
PI (pH):   %s   5.2 (5.00) Peptide Signal:   %s   cut: 31 range:31-421
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRGNNMPRHTSPFLFALLASAATLLSVGDALVVDGLQVGFYGKTCPAAEGVISDIVNNEIAMDRGISPGLIRLFFHDCFITGCDASILLDESPAGDVPEKESSANGFTLVGLRTIDIAKSTVEGMCPGKVSCADILAFAARDAAVAAGLPRYEVAAGRRDGMRSNMDDLPGNFPVPGHHVPRLTELFSQRGLSQEDLVLLSGAHSIGGAHCFMFSNRIYNFSQDADVDPTLDPEYAKWLRQMCPPRQPGDDPEQAPKVKFDAQTGERLDVAYYSELLARRGLLTSDNALIEDPQTRAMVENFARNEPLWQQKFSQAMQKVGMLDVLIGEGKGQVRKQCRLVNGQEKEEKQQQPQEEQEEQQPPELEEEEQQQPHQPQLPWFLQRQRPPVLLPWLRPHPRPRRPFRKHPVADLVNGFFRGFH*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6, intron 1) and 85 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGAGGAAATAACATGCCGCGGCACACGTCGCCGTTCCTTTTTGCCTTGTTGGCGTCGGCGGCGACCCTGCTCAGCGTCGGCGACGCGTTGGTCGTCGACGGCCTGCAGGTGGGGTTC
TATGGCAAGACGTGCCCGGCGGCCGAAGGCGTCATCAGCGACATCGTCAACAACGAAATCGCTATGGACCGGGGCATCTCCCCTGGCCTCATTCGCCTCTTCTTTCACGACTGCTTCATC
ACG
GTAACTAGCTAGCTAGTTAGCACTCACATTTGCTCATGCCTATGCTGCAATGCAACCGCACCGTGAGCTGGTTCTCGTGCAGGGTTGCGACGCTTCCATTCTCCTGGACGAGTCGCC
CGCCGGCGACGTCCCAGAGAAGGAGTCGTCCGCCAACGGCTTCACCCTGGTCGGGCTCAGAACCATCGACATCGCCAAGTCCACCGTAGAGGGCATGTGCCCCGGCAAGGTCTCGTGCGC
AGACATCCTGGCCTTCGCGGCGCGCGACGCCGCCGTGGCCGCGGGCCTCCCGAGATACGAGGTCGCGGCGGGGCGCCGCGACGGCATGCGCTCGAACATGGACGACCTCCCGGGCAACTT
CCCCGTGCCGGGCCACCACGTGCCGCGCCTCACCGAGCTCTTCAGCCAGCGGGGGCTCTCCCAGGAGGACCTCGTCCTGCTCTCCGGCGCGCACTCCATCGGCGGCGCGCACTGCTTCAT
GTTCTCCAACCGCATCTACAACTTCTCCCAGGACGCCGACGTCGACCCCACGCTGGACCCGGAGTACGCCAAGTGGCTGCGCCAGATGTGCCCGCCGCGGCAGCCCGGCGACGACCCCGA
GCAAGCGCCCAAGGTGAAGTTCGACGCGCAGACGGGGGAGCGGCTCGACGTCGCGTACTACTCCGAGCTGCTCGCCCGCCGCGGCCTGCTCACCTCGGACAACGCCCTCATCGAGGACCC
GCAGACGAGGGCGATGGTGGAGAACTTCGCCCGGAACGAGCCACTGTGGCAGCAGAAGTTTTCCCAGGCGATGCAGAAGGTCGGGATGCTTGACGTGCTCATCGGCGAGGGCAAGGGCCA
GGTAAGGAAGCAGTGCCGCCTGGTGAACGGGCAGGAGAAGGAGGAGAAGCAGCAGCAGCCGCAGGAGGAGCAGGAGGAGCAGCAGCCACCGGAGCTGGAGGAGGAGGAGCAGCAGCAGCC
GCATCAGCCACAGCTTCCATGGTTCCTGCAGAGGCAGCGCCCGCCCGTTCTTCTTCCATGGCTCCGGCCCCATCCACGGCCGCGTCGACCGTTCCGGAAACATCCGGTGGCCGACCTGGT
TAACGGATTTTTCCGTGGTTTTCACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGAGGAAATAACATGCCGCGGCACACGTCGCCGTTCCTTTTTGCCTTGTTGGCGTCGGCGGCGACCCTGCTCAGCGTCGGCGACGCGTTGGTCGTCGACGGCCTGCAGGTGGGGTTC
TATGGCAAGACGTGCCCGGCGGCCGAAGGCGTCATCAGCGACATCGTCAACAACGAAATCGCTATGGACCGGGGCATCTCCCCTGGCCTCATTCGCCTCTTCTTTCACGACTGCTTCATC
ACG
GGTTGCGACGCTTCCATTCTCCTGGACGAGTCGCCCGCCGGCGACGTCCCAGAGAAGGAGTCGTCCGCCAACGGCTTCACCCTGGTCGGGCTCAGAACCATCGACATCGCCAAGTCC
ACCGTAGAGGGCATGTGCCCCGGCAAGGTCTCGTGCGCAGACATCCTGGCCTTCGCGGCGCGCGACGCCGCCGTGGCCGCGGGCCTCCCGAGATACGAGGTCGCGGCGGGGCGCCGCGAC
GGCATGCGCTCGAACATGGACGACCTCCCGGGCAACTTCCCCGTGCCGGGCCACCACGTGCCGCGCCTCACCGAGCTCTTCAGCCAGCGGGGGCTCTCCCAGGAGGACCTCGTCCTGCTC
TCCGGCGCGCACTCCATCGGCGGCGCGCACTGCTTCATGTTCTCCAACCGCATCTACAACTTCTCCCAGGACGCCGACGTCGACCCCACGCTGGACCCGGAGTACGCCAAGTGGCTGCGC
CAGATGTGCCCGCCGCGGCAGCCCGGCGACGACCCCGAGCAAGCGCCCAAGGTGAAGTTCGACGCGCAGACGGGGGAGCGGCTCGACGTCGCGTACTACTCCGAGCTGCTCGCCCGCCGC
GGCCTGCTCACCTCGGACAACGCCCTCATCGAGGACCCGCAGACGAGGGCGATGGTGGAGAACTTCGCCCGGAACGAGCCACTGTGGCAGCAGAAGTTTTCCCAGGCGATGCAGAAGGTC
GGGATGCTTGACGTGCTCATCGGCGAGGGCAAGGGCCAGGTAAGGAAGCAGTGCCGCCTGGTGAACGGGCAGGAGAAGGAGGAGAAGCAGCAGCAGCCGCAGGAGGAGCAGGAGGAGCAG
CAGCCACCGGAGCTGGAGGAGGAGGAGCAGCAGCAGCCGCATCAGCCACAGCTTCCATGGTTCCTGCAGAGGCAGCGCCCGCCCGTTCTTCTTCCATGGCTCCGGCCCCATCCACGGCCG
CGTCGACCGTTCCGGAAACATCCGGTGGCCGACCTGGTTAACGGATTTTTCCGTGGTTTTCACTGA

Retrieve as FASTA