Entry information : VaaCP02 (VaaKatG2)
Entry ID 7191
Creation 2010-02-08 (Marcel Zamocky)
Last sequence changes 2011-05-19 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-05-19 (Christophe Dunand)
Peroxidase information: VaaCP02 (VaaKatG2)
Name (synonym) VaaCP02 (VaaKatG2)
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Verticillium
Organism Verticillium albo-atrum    [TaxId: 27335 ]
Cellular localisation Secreted
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value VaaCP02
start..stop
S start..stop
VdaCP02 1566 0 1..772 1..772
GgrCP02 1157 0 6..772 2..772
CgloCP01_ST23 1154 0 2..772 1..774
NhaeCP02 1152 0 14..772 16..778
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2398..2695 298 N° 2 2135..2289 155 N° 3 1993..2065 73 N° 4 1492..1923 432
N° 5 1302..1434 133 N° 6 21..1248 1228  
complement(join(21..1248,1302..1434,1492..1923,1993..2065,2135..2289,2398..2695) )


exon

Literature and cross-references VaaCP02 (VaaKatG2)
Literature Ma L.-J.J., Klosterman S.J., Subbarao K., Dobinson K., Veronese P., Kang S., Gold S.E., Young S., Jaffe D., Gnerre S., Berlin A., Heiman D., Hepburn T., Sykes S., Chen Z., Alvarado L., Kodira C.D., Lander E. , Galagan J., Nusbaum C., Birren B. Annotation of Verticillium albo-atrum VaMs.102. The Broad Institute Genome Sequencing Platform;
unpublished since 2008.
Protein ref. UniProtKB:   C9SWU2
DNA ref. GenBank:   ABPE01003931.1 (22997..20323)
Protein sequence: VaaCP02 (VaaKatG2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   772 (753)
PWM (Da):   %s   84297.37 (82352.3)  
PI (pH):   %s   6.91 (6.92) Peptide Signal:   %s   cut: 20 range:20-772
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLYSTLAGCLLTALPIVNAAGTCPFSKREESSETLDKRQSNAIPNFGRCAVQSNVAGGGTRSSDWWPCQLRLDILRQFSSEINPEGGDFDYTEAFKTLDYAALKKDLLTLMTDSQDWWPADFGHYGGFFIRMAWHSAGTYRALDGRGGGGGQQRFAPLNSWPDNQNLDKARRLLWPIKQKYGNKISWADLMLLTGNVALESMDFKPFGFAGGRPDTWQSDEGIYWGAETAFVPQGNDVRYNGSTDVRERAEHLEKPLAATHMGLIYVNPEGPNGNSIPADSALDIRVAFDRMGMNDEETVALIAGGHAFGKTHGAVKGENIGPEPEANDMGMGLGWHNRVNNGNGPDTMTSGLEVIWTKTPTKWSNGYLLSLLNNQWELVESPAGSKQWQAINGTIDYPDPFDKTKFRPATMLTSDLALINDPSYLKICKRWVDHPEELADAFARAWFKLLHRDMGPRSRYLGPEVPKEQLIWQDPLPAAKGSPINDADVASLKKTILSTSGLTVSNLVTVAWGSASTYRNSDKRGGANGGRIALEPQRSWAVNNPAQLTKVLTALKGVQSRFNRNGKSVSLADLIVLGGTAAVEKAARDAGFNIVVPFAPGRVDATQDQTDVTSFGHLQPAADGFRNYGQSTARARAEEILVDKASQLKLSPPELAVLVGGLRVLGANFDGSKKGVLTSKVGRLTNDYFVNLLDIRTNWTPDSSSEVWTGKDRATGATKWTATRADLVFGSHAELRAVSEVYGSADAAEKFVRDFVKAWVKVMNLDRFDL

Retrieve as FASTA  
Remarks Complete sequence from genomic (5 introns). Strain="VaMs.102". Fungal catalase-peroxidase of the second groug from a plant pathogenic fungus causing e.g. wilt diseases.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTGTACTCCACTCTAGCTGGCTGTCTCCTGACAGCCCTGCCTATCGTCAACGCTGCCGGCACCTGTCCCTTCTCCAAGCGCGAGGAGTCCTCCGAGACTCTCGACAAGAGGCAGAGC
AACGCCATCCCCAACTTTGGACGATGCGCCGTCCAGAGCAACGTTGCTGGCGGTGGCACCAGGAGCAGTGACTGGTGGCCTTGCCAACTGAGGCTCGATATCCTGCGCCAGTTCTCCTCA
GAGATCAACCCTGAAGGCGGCGACTTTGATTACACCGAGGCTTTCAAGACCTTGGACT
GTGAGTTTATTCTAATCTCCTAGAGTAAAAGCTTCATAGCCTCATTAGAGGCTGTGTGCAAC
CAACCTTTCGCTAGCTGTGGCGCATGCTGACGAGAAACCATCTCAGACGCCGCCCTGAAGAAGGATCTGCTCACGCTCATGACGGATTCTCAGGACTGGTGGCCGGCTGACTTTGGTCAC
TATGGTGGCTTCTTCATCCGCATGGCTTGGCACAGCGCCGGTACCTACCGCGCTCTCGATGGCCGCGGTGGTGGTGGCATG
GTAAGTGGCGGCGCCTCGCTCCCGTCATCCGTCAGCCAA
CATCGGCAGCTAACGTGAGACTGGAAATAGGGCCAACAGCGTTTTGCGCCCCTCAACAGCTGGCCTGATAACCAGAACCTCGACAAGGCTCGTCGCCTGCTTTGTAAGTCCAACACGAGT
TCTACTCTCAAAGCCATTTCCGAAGTTACCGAAAGCTGACCTCTGTCTGCAGGGCCCATCAAGCAGAAGTATGGCAACAAGATCTCCTGGGCTGACCTCATGCTTCTCACCGGCAACGTG
GCTCTCGAGTCCATGGACTTTAAGCCCTTCGGCTTTGCTGGTGGTCGTCCCGACACCTGGCAGTCCGACGAAGGCATCTACTGGGGTGCCGAGACCGCCTTCGTTCCTCAGGGTAACGAT
GTTCGTTACAACGGCAGCACCGATGTTCGTGAGCGCGCTGAGCACCTCGAGAAGCCGCTCGCTGCCACTCACATGGGCCTGATCTATGTCAACCCCGAGGGACCTAACGGCAACTCGATC
CCCGCCGACTCTGCTCTCGATATCCGTGTGGCTTTTGACCGCATGGGTATGAACGATGAGGAGACTGTCGCTCTCATTGCCGGTGGACACGCCTTTGGCAAGACCCACGGCGCTGTCAAG
GGTG
GTATGTTCTTAGTTCTTGATCCAGCTCCTTCTCTCCAGAGCTAACATGCCCATCCAGAGAACATCGGCCCCGAGCCTGAGGCCAACGACATGGGAATGGGCCTCGGCTGGCACAAC
CGCGTCAACAACGGAAACGGCCCCGACACCATGACCAGTGGCCTAGAGGTCATCTGGACCAAGACGCCCACCAA
GTAAGCATCCCCAGAGTCGATTGCCCGATGTTTACTGACGGGTATT
TATCTAGGTGGAGCAACGGCTACCTTCTCAGTCTGTTGAACAACCAGTGGGAGCTTGTTGAGAGCCCTGCCGGCTCCAAGCAGTGGCAAGCCATCAACGGAACCATCGACTACCCCGACC
CATTCGACAAGACGAAGTTCCGCCCTGCCACTATGCTCACTAGCGATCTTGCTCTCATCAACGACCCCTCGTACCTGAAGATTTGCAAGCGCTGGGTCGACCACCCCGAGGAGCTCGCCG
ACGCCTTCGCCCGTGCCTGGTTCAAGCTTCTGCACCGTGACATGGGACCCCGTTCTCGCTACCTCGGCCCTGAGGTGCCTAAGGAACAGCTCATCTGGCAGGACCCTCTCCCTGCCGCCA
AGGGCAGCCCCATCAACGACGCCGATGTCGCCTCGTTGAAGAAGACTATTCTTTCCACTTCAGGCCTGACCGTCTCCAACCTCGTGACTGTTGCCTGGGGCTCCGCCTCAACCTACCGCA
ACTCAGACAAGCGTGGTGGTGCCAACGGTGGCCGCATCGCTCTCGAGCCCCAGCGCAGTTGGGCCGTTAACAACCCCGCTCAGCTGACCAAGGTCCTCACTGCCCTCAAGGGCGTCCAGA
GCAGGTTCAACCGCAACGGCAAGAGCGTCTCTCTCGCTGATCTCATCGTCCTCGGTGGTACTGCCGCCGTCGAGAAGGCCGCCAGGGATGCCGGGTTCAACATTGTCGTTCCCTTTGCCC
CTGGTCGTGTCGATGCCACCCAGGACCAGACCGACGTTACATCCTTCGGCCACCTTCAGCCCGCGGCCGACGGCTTCCGCAACTACGGCCAGAGCACGGCCCGCGCCCGCGCCGAGGAGA
TCCTTGTTGACAAGGCCTCCCAGCTCAAGCTCAGCCCTCCCGAGCTCGCTGTTCTCGTCGGCGGCCTCCGCGTTCTGGGCGCCAACTTTGACGGCTCCAAGAAGGGTGTTCTGACGTCCA
AGGTCGGCCGCCTGACTAACGACTACTTTGTCAATCTCCTTGACATCCGCACCAACTGGACTCCCGACAGCAGCTCCGAGGTCTGGACTGGCAAGGACCGTGCCACCGGTGCCACCAAGT
GGACCGCCACGCGCGCCGACCTCGTTTTCGGTTCTCACGCAGAGCTCCGCGCCGTTTCTGAGGTGTACGGCAGCGCTGACGCCGCTGAGAAATTTGTCAGGGACTTTGTTAAGGCTTGGG
TTAAGGTCATGAACCTTGACCGCTTTGACCTTTAG

Retrieve as FASTA