Entry information : SmAPx03-1_65 (SmAPx03a_65)
Entry ID 7198
Creation 2010-02-10 (Christophe Dunand)
Last sequence changes 2010-02-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmAPx03-1_65 (SmAPx03a_65)
Name (synonym) SmAPx03-1_65 (SmAPx03a_65)
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation Chloroplastic
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmAPx03-1_65
start..stop
S start..stop
SmAPx03-2_72 714 0 1..348 1..348
LeAPx07 475 8e-170 11..343 4..345
GmAPx08 474 5e-169 49..346 51..348
MguAPx03 473 2e-168 52..345 68..361
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 250014..250151 138 N° 2 249800..249955 156 N° 3 249600..249720 121 N° 4 249444..249544 101
N° 5 249296..249383 88 N° 6 249139..249206 68 N° 7 248983..249069 87 N° 8 248848..248922 75
N° 9 248703..248780 78 N° 10 248540..248644 105 N° 11 248461..248490 30  
complement(join(248461..248490,248540..248644,248703..248780,248848..248922,2489 83..249069,249139..249206,249296..249383,249444..249544,249600..249720,249800..2 49955,250014..250151))


exon

Literature and cross-references SmAPx03-1_65 (SmAPx03a_65)
DNA ref. Phytozome 11:   scaffold_65 (250151..248461)
mRNA ref. JGI transcript:   156990
Cluster/Prediction ref. UniGene:   Smo.7135
Protein sequence: SmAPx03-1_65 (SmAPx03a_65)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   349 (323)
PWM (Da):   %s   37778.34 (35215.0)  
PI (pH):   %s   8.92 (8.60) Peptide Signal:   %s   cut: 26 range:26-348
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAMASARSIVFSGALLCKSLPAVTARLSIAAAPHRRLSSSGLSLRAACSRRIRTFAMSGSGAAAVESSQRIASQLDQLVGAREAIKEVITKMHCNPIVIRLGWHDAGTYDKNISEWPKCGGANGSLRFPIELEHGANAGLINALKLLNPVKEKFTAVSYADLFQLASATAIMAGGPRIPMRYGRVDTVGPEQCPKEGNLPSAGPPNPSEHLRKVFHRMGLDDDIVALSGAHTLGRSRPERSGWGKKETKYTKDGPGAPGGQSWTVEWLKFDNSYFKDIKEKRDEDLLVLPTDAVLFEDPGFKEHAELYAKDQDAFFKDYAQAHAKLSELGAKFDPPQGIRIDESTS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (10 introns) and 15 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGATGGCGTCGGCGAGGTCGATCGTTTTCTCCGGGGCGCTTCTCTGCAAATCTCTTCCTGCTGTCACTGCGAGGCTCAGCATTGCTGCGGCGCCTCATCGGCGGCTCTCATCATCG
GGTTTGTCGCTCCGTGCG
GTGAGTGTTTGCCTCCTCTCTTTCTCGATGTCGATGGATCGTGTTTGCAACCGATCAGGCCTGCTCGCGGAGGATCAGAACTTTTGCCATGTCTGGGAGTGG
AGCCGCCGCCGTGGAATCGTCCCAGAGGATCGCGTCTCAGCTCGATCAGCTAGTGGGAGCGAGGGAAGCGATCAAGGAAGTGATCACGAAAATGCATTGCAATCCTATAGTA
GTAAGTGT
CAAAAAAAACACTCGCACTGTTTTCTTTATTTTTCAACGATCAAACCTTGTGAGCTCTTTCAAATCGACAGATTAGATTGGGATGGCACGACGCTGGAACGTATGACAAGAACATCAGCG
AGTGGCCCAAGTGTGGTGGTGCCAATGGAAGCCTGCGCTTCCCTATCGAGTTGGAACATGGAGCGAATGCTG
GTAACTTTTAGGAACTTGCGAAAAGCTTGGAACGATCCCTTCGAACTT
ACGGCAGGACTCATAAATGCTCTCAAGCTGCTTAATCCCGTGAAGGAGAAATTCACCGCAGTAAGCTATGCCGATCTTTTCCAGCTTGCAAGCGCCACCGCCATAGAGGTAAACTTATCA
AGAAAGAACAAAGAAGCCGGCCTAAACTTCTAAAGGTGATGGAATCAGATGGCTGGAGGACCCCGGATTCCAATGCGATATGGAAGAGTTGATACCGTAGGCCCAGAGCAATGCCCGAAG
GAGGGTAACCTTCCAA
GTAAGAATGAGTTTTCCAAGCGCTAGCCAACTTGGACTTCGACAAATGATGTCCGTTTCTTTGACGCCTGGAATTAATTTTCTTTCCAGGTGCCGGACCCCCAA
ATCCTTCCGAGCACCTTCGCAAAGTGTTTCACAGGATGGGACTGGATGACAAG
GTGCGCTTTCCGCTTTGAAGAATTTTCCTGGCTTGAGCAGACTTTTACTCATCGCCTTGATATACCA
AGGACATTGTTGCCCTGTCAGGTGCTCATACCTTGGGACGATCTAGACCAGAACGGAGTGGCTGGGGAAAAAAGGAAACGAAATACACGGTAACGAAAGTGGTTCTTTCAGAAGCTTCGA
TGACATTTTGATGCTTGAGACCATGATAGAAAGACGGACCTGGAGCTCCAGGAGGCCAGTCCTGGACTGTGGAATGGCTGAAATTTGACAATTCATATTTCAAGGTAGACTTTATTCCAA
GGACGAAAAAAAAATTTGGATAGTAGTGAACGCCGGTTGTATCGTATGCAGGATATCAAGGAGAAAAGAGACGAAGATCTTCTCGTCTTGCCAACTGACGCAGTCCTTTTCGAAGATCCA
GGATTCAAG
GTAAAGAATAGACCAACTTAAGAAAATTAGAAAAACTTATCTCAATGTATATCTCCAGGAGCATGCCGAGCTCTACGCCAAGGATCAGGACGCGTTCTTCAAGGACTATGC
TCAAGCGCATGCCAAGCTGAGTGAACTGGGAGCCAAATTCGATCCACCTCAA
GTTTGTAGCTCTTGTTCTCCTCCTTGTTGGCTGACTGATGTGGTTGCAGGGAATCCGGATCGACGAGA
GCACAAGTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGATGGCGTCGGCGAGGTCGATCGTTTTCTCCGGGGCGCTTCTCTGCAAATCTCTTCCTGCTGTCACTGCGAGGCTCAGCATTGCTGCGGCGCCTCATCGGCGGCTCTCATCATCG
GGTTTGTCGCTCCGTGCG
GCCTGCTCGCGGAGGATCAGAACTTTTGCCATGTCTGGGAGTGGAGCCGCCGCCGTGGAATCGTCCCAGAGGATCGCGTCTCAGCTCGATCAGCTAGTGGGA
GCGAGGGAAGCGATCAAGGAAGTGATCACGAAAATGCATTGCAATCCTATAGTA
ATTAGATTGGGATGGCACGACGCTGGAACGTATGACAAGAACATCAGCGAGTGGCCCAAGTGTGGT
GGTGCCAATGGAAGCCTGCGCTTCCCTATCGAGTTGGAACATGGAGCGAATGCTG
GACTCATAAATGCTCTCAAGCTGCTTAATCCCGTGAAGGAGAAATTCACCGCAGTAAGCTATGCC
GATCTTTTCCAGCTTGCAAGCGCCACCGCCATAGAG
ATGGCTGGAGGACCCCGGATTCCAATGCGATATGGAAGAGTTGATACCGTAGGCCCAGAGCAATGCCCGAAGGAGGGTAACCTT
CCAA
GTGCCGGACCCCCAAATCCTTCCGAGCACCTTCGCAAAGTGTTTCACAGGATGGGACTGGATGACAAGGACATTGTTGCCCTGTCAGGTGCTCATACCTTGGGACGATCTAGACCA
GAACGGAGTGGCTGGGGAAAAAAGGAAACGAAATACACG
AAAGACGGACCTGGAGCTCCAGGAGGCCAGTCCTGGACTGTGGAATGGCTGAAATTTGACAATTCATATTTCAAGGATATC
AAGGAGAAAAGAGACGAAGATCTTCTCGTCTTGCCAACTGACGCAGTCCTTTTCGAAGATCCAGGATTCAAG
GAGCATGCCGAGCTCTACGCCAAGGATCAGGACGCGTTCTTCAAGGAC
TATGCTCAAGCGCATGCCAAGCTGAGTGAACTGGGAGCCAAATTCGATCCACCTCAA
GGAATCCGGATCGACGAGAGCACAAGTTAG

Retrieve as FASTA