Entry information : SmAPx03-2_72 (SmAPx03b_72)
Entry ID 7199
Creation 2010-02-10 (Christophe Dunand)
Last sequence changes 2010-02-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmAPx03-2_72 (SmAPx03b_72)
Name (synonym) SmAPx03-2_72 (SmAPx03b_72)
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation Chloroplastic
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmAPx03-2_72
start..stop
S start..stop
SmAPx03-1_65 714 0 1..348 1..348
LeAPx07 477 1e-170 11..343 4..345
GmAPx08 476 5e-170 49..346 51..348
MguAPx03 475 2e-169 52..345 68..361
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 297807..297944 138 N° 2 297593..297748 156 N° 3 297403..297523 121 N° 4 297247..297347 101
N° 5 297099..297186 88 N° 6 296942..297009 68 N° 7 296786..296872 87 N° 8 296651..296725 75
N° 9 296504..296581 78 N° 10 296341..296445 105 N° 11 296262..296291 30  
complement(join(296262..296291,296341..296445,296504..296581,296651..296725,2967 86..296872,296942..297009,297099..297186,297247..297347,297403..297523,297593..2 97748,297807..297944))


exon

Literature and cross-references SmAPx03-2_72 (SmAPx03b_72)
DNA ref. Phytozome 11:   scaffold_72 (297944..296262)
mRNA ref. JGI transcript:   157825
Protein sequence: SmAPx03-2_72 (SmAPx03b_72)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   348 (323)
PWM (Da):   %s   37695.3 (35219.0)  
PI (pH):   %s   8.92 (8.60) Peptide Signal:   %s   cut: 26 range:26-348
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAMASARSIVFSGALLCKSLPAVTARLSIAAAPHRRLSSSGLSLRAACSRRIRTFAMSGSGAAAVESSQRIASQLDQLVGAREAIKEVITKMHCNPILIRLGWHDAGTYDKNISEWPKCGGANGSLRFSIELEHGANAGLINALKLLNPVKEKFTAVSYADLFQLASATAIMAGGPRIPMRYGRVDTVGPEQCPKEGNLPSAGPPNPSEHLRKVFHRMGLDDDIVALSGAHTLGRSRPERSGWGKKETKYTKDGPGAPGGQSWTVEWLKFDNSYFKDIKEKRDEDLLVLPTDAVLFEDPGFKEHAELYAKDQDAFFKDYAQAHAKLSELGAKFDPPQGIRIDESTS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (10 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGATGGCGTCGGCGAGGTCGATCGTTTTCTCCGGGGCGCTTCTCTGCAAATCTCTCCCTGCTGTCACTGCCAGGCTCAGCATTGCTGCGGCGCCTCATCGGCGGCTCTCATCATCG
GGTTTGTCGCTCCGTGCG
GTGAGTGTTTGCCTCCTCTCTTTCTCGATGTCGATGGATCGTGTTTGCAACCGATCAGGCCTGCTCGCGGAGGATCAGAACTTTTGCCATGTCTGGGAGTGG
AGCCGCCGCCGTGGAATCGTCCCAGAGGATCGCGTCTCAGCTCGATCAGCTAGTGGGAGCGAGGGAAGCGATCAAGGAAGTGATCACGAAAATGCATTGCAATCCTATACTA
GTAAGTAA
CAAAAAACTGTTTTCTTTTTTTTTCAACGATCAAACCTTGTGAGCTCTTTCGAATCGACAGATTAGATTGGGATGGCACGACGCTGGAACGTATGACAAGAACATCAGCGAGTGGCCCAA
GTGTGGTGGTGCCAATGGAAGCCTGCGCTTCTCTATCGAGTTGGAACATGGAGCGAATGCTG
GTAACTTTTAGCAACTTGCGAAAAGCTTGTAACGATCCCTTCGAACTTACGGCAGGAC
TCATAAATGCTCTCAAGCTGCTTAATCCCGTGAAGGAGAAATTCACCGCAGTAAGCTATGCCGATCTTTTCCAGCTTGCAAGCGCCACCGCCATAGAG
GTAAACTTATCAAGAAAGAACA
AAGAAGCTGGCCTAAACTTCTAAAGGTGATGGAATCAGATGGCTGGAGGACCCCGGATTCCAATGCGATATGGAAGAGTTGATACCGTAGGCCCAGAGCAATGCCCGAAGGAGGGTAACC
TTCCAA
GTAAGAATGAGTTTTCCAAGCGCTAGCCAACTTGGACTTCGACAAATGGTGTCCGTTCCTCTGACGCCTGGAATTAATTTTTTTTCCAGGTGCCGGACCCCCAAATCCTTCCGA
GCACCTTCGCAAAGTGTTTCACAGGATGGGACTGGATGACAAG
GTGCGCTTTCCGCTTTGAAGAATTTTCCTGGCTTGAGCAGACTTTTACTCATCGCCTTGATATACCAAGGACATTGT
TGCCCTGTCAGGTGCTCATACCTTGGGACGATCTAGACCAGAACGGAGTGGCTGGGGAAAAAAGGAAACGAAATACACG
GTAACGAAAGTGGTTCTTTCAGCATCTTCGATGACATTTTG
ATGCTTGAGAACATGATAGAAAGACGGACCTGGAGCTCCAGGAGGCCAGTCCTGGACTGTGGAATGGCTGAAATTTGACAATTCATATTTCAAGGTAGACTTTATTTCAAGGCCGGCAAA
AGAAAATTTGGATAGTAGTGAACGCTGGTCGTATCGTATGCAGGATATCAAGGAGAAAAGAGACGAAGATCTTCTCGTCTTGCCAACGGACGCAGTCCTTTTCGAAGATCCAGGATTCAA
G
GTAAAGAATAGACCAACTTAAGAAAATTAGAAAAACTTATCTCAATGTGTATCTCCAGGAGCATGCCGAGCTCTACGCCAAGGATCAGGATGCGTTCTTCAAGGACTATGCTCAAGCGC
ATGCCAAGCTGAGTGAACTGGGAGCCAAATTCGATCCACCTCAA
GTTTGTAGCTCTTGTTCTCCTCCTTGTTGGCTGACTGATGTGGTTGCAGGGAATCCGGATCGACGAGAGCACAAGT
TAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGATGGCGTCGGCGAGGTCGATCGTTTTCTCCGGGGCGCTTCTCTGCAAATCTCTCCCTGCTGTCACTGCCAGGCTCAGCATTGCTGCGGCGCCTCATCGGCGGCTCTCATCATCG
GGTTTGTCGCTCCGTGCG
GCCTGCTCGCGGAGGATCAGAACTTTTGCCATGTCTGGGAGTGGAGCCGCCGCCGTGGAATCGTCCCAGAGGATCGCGTCTCAGCTCGATCAGCTAGTGGGA
GCGAGGGAAGCGATCAAGGAAGTGATCACGAAAATGCATTGCAATCCTATACTA
ATTAGATTGGGATGGCACGACGCTGGAACGTATGACAAGAACATCAGCGAGTGGCCCAAGTGTGGT
GGTGCCAATGGAAGCCTGCGCTTCTCTATCGAGTTGGAACATGGAGCGAATGCTG
GACTCATAAATGCTCTCAAGCTGCTTAATCCCGTGAAGGAGAAATTCACCGCAGTAAGCTATGCC
GATCTTTTCCAGCTTGCAAGCGCCACCGCCATAGAG
ATGGCTGGAGGACCCCGGATTCCAATGCGATATGGAAGAGTTGATACCGTAGGCCCAGAGCAATGCCCGAAGGAGGGTAACCTT
CCAA
GTGCCGGACCCCCAAATCCTTCCGAGCACCTTCGCAAAGTGTTTCACAGGATGGGACTGGATGACAAGGACATTGTTGCCCTGTCAGGTGCTCATACCTTGGGACGATCTAGACCA
GAACGGAGTGGCTGGGGAAAAAAGGAAACGAAATACACG
AAAGACGGACCTGGAGCTCCAGGAGGCCAGTCCTGGACTGTGGAATGGCTGAAATTTGACAATTCATATTTCAAGGATATC
AAGGAGAAAAGAGACGAAGATCTTCTCGTCTTGCCAACGGACGCAGTCCTTTTCGAAGATCCAGGATTCAAG
GAGCATGCCGAGCTCTACGCCAAGGATCAGGATGCGTTCTTCAAGGAC
TATGCTCAAGCGCATGCCAAGCTGAGTGAACTGGGAGCCAAATTCGATCCACCTCAA
GGAATCCGGATCGACGAGAGCACAAGTTAG

Retrieve as FASTA