Entry information : SmAPx05-1_109 (SmAPx05a_109)
Entry ID 7202
Creation 2010-02-10 (Christophe Dunand)
Last sequence changes 2010-02-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmAPx05-1_109 (SmAPx05a_109)
Name (synonym) SmAPx05-1_109 (SmAPx05a_109)
Class Ascorbate peroxidase    [Orthogroup: APx016]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmAPx05-1_109
start..stop
S start..stop
SmAPx05-2_59 583 0 1..286 1..286
HarAPx03 386 1e-136 5..246 3..244
LsaAPx02 385 2e-136 5..280 3..274
NtAPx05-1A 385 3e-136 6..246 4..244
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 505184..505302 119 N° 2 504999..505123 125 N° 3 504892..504941 50 N° 4 504759..504824 66
N° 5 504656..504704 49 N° 6 504498..504580 83 N° 7 504369..504448 80 N° 8 504196..504298 103
N° 9 503960..504145 186  
complement(join(503960..504145,504196..504298,504369..504448,504498..504580,5046 56..504704,504759..504824,504892..504941,504999..505123,505184..505302))


exon

Literature and cross-references SmAPx05-1_109 (SmAPx05a_109)
DNA ref. Phytozome 11:   scaffold_109 (505302..503960)
mRNA ref. JGI transcript:   131845
Protein sequence: SmAPx05-1_109 (SmAPx05a_109)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   286
PWM (Da):   %s   31625.75 Transmb domain:   %s   o263-285i
PI (pH):   %s   4.67
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAEVPLVDDEYVMEIEEARQELRGMIVEKQCAPIMLRLAWHDAGTYDRETKTGGPNGSIRLEGEYNHFANRGIKAAIDLEEIKEKCPKISYADLYLAGVTAVEVTGGPTINFVSGRKDSSVIPPEGRLPDASQGANHLRDVFGRMGLNDKDIVALSGGHTGRAHKDRSGFDGPWTSNPLTFDNSYFIELIEGEKTGLLKLPTDTCLMDDKVFRQYVETYADKDTFFRDYAWSHKKLSELGFIDHPDETQENTYDSSFTSITILIGVVITAAAVGLVAMIWS*

Retrieve as FASTA  
Remarks Complete sequence from geneomic (8 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCTGAAGTTCCCCTTGTTGATGATGAGTATGTCATGGAAATCGAGGAGGCCAGGCAAGAGCTCCGTGGAATGATTGTTGAGAAGCAATGTGCTCCGATCATGCTAAGGCTAGCG
TAAGTGAATATATGGAGCTTGGTTTATTTGTATGATCTTGAAACATTTTTTTCTTTAAGGTGGCATGATGCAGGAACCTATGATCGGGAAACAAAAACAGGAGGTCCAAATGGATCAATT
CGACTAGAGGGTGAATATAATCATTTTGCAAATAGGGGCATTAAGGCTGCTATTGATCTTTGTG
GTGAGTAGAGTTTACTTTTGGCTGAATTCTGCGGTAATCATGATTTATTTTTTCTA
GAGGAAATCAAAGAGAAGTGCCCCAAAATAAGCTATGCAGATCTTTACCAGGTTTGCATATTGAAATAAAAAGATAAATAATGTATCTGGCTCATATATATGTTGTTTGGATAATTAGCT
AGCAGGAGTTACAGCAGTGGAAGTCACTGGAGGACCAACAATCAATTTTGTTTCAGGAAGAAAA
GTATGGTAAAACATTAATCTTTGAACACCATGCATTTTCTTTTTTTTCTTACAGGA
TTCTTCAGTAATACCCCCTGAAGGGCGTTTACCAGATGCTTCTCAAG
GTCATTGATAATTTCTAAATACTTTTCTTATTGATATGATAATTTTCATTTATGATCTCTAAATTTGCAATTT
AGGTGCAAATCACTTGAGAGATGTTTTTGGTAGGATGGGCTTAAATGACAAAGATATAGTTGCATTATCTGGTGGTCATACACTGGTGAGACCTTTGGGATTTATAAAGTTTTTTTTAAA
GACATTTTTGGCAGGGAAGAGCTCACAAGGACAGATCAGGATTTGATGGACCATGGACATCAAATCCTCTGACCTTTGACAATTCTTATTTCATGTATAAGTCTTTCTTCCTGTTCAAGT
CTTTTTTTTTACCATTTTTTTTTTCTTCTATCCCATGTGAATAGTGAGCTGATTGAAGGAGAAAAAACTGGACTTTTAAAGCTACCAACAGATACGTGTTTGATGGATGACAAAGTATTT
CGTCAATATGTTGAAACTTATGCCAAG
GTAATCGATCACAAGGTTTGTGGAGATGATTATAATAATTTCGAGAGCAGGATAAAGACACATTTTTCCGTGATTATGCGTGGTCTCATAAGA
AATTATCTGAGCTCGGTTTCATCGATCACCCAGATGAAACCCAAGAGAACACATATGATAGCTCATTCACATCAATCACCATATTAATTGGAGTGGTGATCACAGCAGCAGCAGTGGGTT
TAGTTGCAATGATATGGTCATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCTGAAGTTCCCCTTGTTGATGATGAGTATGTCATGGAAATCGAGGAGGCCAGGCAAGAGCTCCGTGGAATGATTGTTGAGAAGCAATGTGCTCCGATCATGCTAAGGCTAGCG
TGGCATGATGCAGGAACCTATGATCGGGAAACAAAAACAGGAGGTCCAAATGGATCAATTCGACTAGAGGGTGAATATAATCATTTTGCAAATAGGGGCATTAAGGCTGCTATTGATCTT
TGTG
AGGAAATCAAAGAGAAGTGCCCCAAAATAAGCTATGCAGATCTTTACCAGCTAGCAGGAGTTACAGCAGTGGAAGTCACTGGAGGACCAACAATCAATTTTGTTTCAGGAAGAAAA
GATTCTTCAGTAATACCCCCTGAAGGGCGTTTACCAGATGCTTCTCAAGGTGCAAATCACTTGAGAGATGTTTTTGGTAGGATGGGCTTAAATGACAAAGATATAGTTGCATTATCTGGT
GGTCATACACTG
GGAAGAGCTCACAAGGACAGATCAGGATTTGATGGACCATGGACATCAAATCCTCTGACCTTTGACAATTCTTATTTCATTGAGCTGATTGAAGGAGAAAAAACTGGA
CTTTTAAAGCTACCAACAGATACGTGTTTGATGGATGACAAAGTATTTCGTCAATATGTTGAAACTTATGCCAAG
GATAAAGACACATTTTTCCGTGATTATGCGTGGTCTCATAAGAAA
TTATCTGAGCTCGGTTTCATCGATCACCCAGATGAAACCCAAGAGAACACATATGATAGCTCATTCACATCAATCACCATATTAATTGGAGTGGTGATCACAGCAGCAGCAGTGGGTTTA
GTTGCAATGATATGGTCATGA

Retrieve as FASTA