Entry information : SmAPx02-2_60 (SmAPx02b_60)
Entry ID 7204
Creation 2010-02-10 (Christophe Dunand)
Last sequence changes 2010-02-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmAPx02-2_60 (SmAPx02b_60)
Name (synonym) SmAPx02-2_60 (SmAPx02b_60)
Class Ascorbate peroxidase    [Orthogroup: APx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmAPx02-2_60
start..stop
S start..stop
SmAPx02-1_0 612 0 1..299 1..299
PpaAPx03 457 3e-164 1..295 1..297
SpraAPx03 444 4e-159 1..299 1..302
HaAPx03 441 4e-158 1..296 1..284
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 295482..295594 113 N° 2 295307..295431 125 N° 3 295207..295256 50 N° 4 295076..295141 66
N° 5 294970..295018 49 N° 6 294819..294901 83 N° 7 294676..294755 80 N° 8 294511..294613 103
N° 9 294207..294437 231  
complement(join(294207..294437,294511..294613,294676..294755,294819..294901,2949 70..295018,295076..295141,295207..295256,295307..295431,295482..295594))


exon

Literature and cross-references SmAPx02-2_60 (SmAPx02b_60)
DNA ref. Phytozome 11:   scaffold_60 (295594..294207)
mRNA ref. JGI transcript:   271672
EST ref. GenBank:   FE467531.1 [3' end]
Cluster/Prediction ref. UniGene:   Smo.4450
Protein sequence: SmAPx02-2_60 (SmAPx02b_60)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   299
PWM (Da):   %s   32512.65 Transmb domain:   %s   o268-290i
PI (pH):   %s   7.11
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPVPVVDNAYLKAIESARRDLRAFIAEKNCAPLMLRLAWHDAGTYDAVSKTGGPNGSIRSEREYTHAANNGLKIAIDFEPIKEKHPTITYADLYLAGVVAVEVTGGPTIDFVPGRKDSVATTPEGRLPDAHLGAKHIRDVFFRMGLSDKDIVALSGGHTGRGHKERSGFEGPWTPQPLKFDNSYFKELLRGESEGLLQLPTDKCLLEDPSFRPYVDLYADEDAFFKDYAESHKKLSELGCKHTSPAFGNAKASLAVDSHASTATVLAHSAFGLAVSAIVVVLSYAYEVRRKTALK*

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns) and 13 ESTs. ESTs from two varaiants are compiled in the same unigene.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCGGTGCCCGTCGTCGACAATGCGTACCTCAAGGCGATCGAATCCGCCAGGCGCGATCTCCGAGCTTTCATCGCCGAGAAGAATTGCGCGCCTCTGATGCTGCGATTGGCGTAAGTT
TCCACTCTTGATTCCAGCTCCTCTTGATTTCTAGCTCTCTCAGATGGCACGATGCTGGCACTTACGATGCCGTGTCCAAGACTGGAGGACCGAATGGCTCGATCCGGAGCGAGCGGGAGT
ACACTCACGCTGCCAACAATGGGCTCAAAATTGCCATTGATTTCTGTG
GTGAGTGCTACTTTTTGGAGATTATATGCTATAGAAACATTGTTTCGCAGAGCCTATCAAGGAGAAACACCC
GACTATCACTTACGCGGATCTCTACCAG
GTGCATGGATTTTCTCTTTTCTTTTTGTGGTAATGGTCAATTTTAATTTTTTTCTCGCTTATCAGCTAGCTGGAGTTGTGGCTGTAGAGGTA
ACTGGAGGACCTACGATCGATTTTGTGCCTGGCCGAAAG
GTTTTGTTTCTGTTTGAGCTCTTTTTGATCAGTAGAAAACATGAAACTTGTCCATAGGATTCCGTCGCTACTACACCAGAA
GGACGACTTCCCGATGCTCATCTAG
GTTTGTATCATTCATTCTATGTAGCTATGAGTTTACAAGCTCGGGATGGCTGTTTTTTTTTTTTTCAGGGGCAAAACATATCCGTGACGTGTTCT
TTAGAATGGGTCTTTCTGACAAAGATATCGTCGCCCTCTCGGGAGGTCACACAATA
GTAAGTCTCTCCTGTTTTATAGAACAATAAAAGTTTGTTTTTTGTTTTTTTCTTTTTTTTCAGG
GAAGAGGTCACAAGGAGAGATCCGGCTTTGAGGGACCATGGACACCACAGCCATTGAAGTTCGACAATTCGTACTTCAA
GTAAGTCTCAGCTCCTTACTCTCTTTTTTTGGTGTCTTACG
TATAGTCCGAACAAACACTAGGGAGCTCTTGAGAGGAGAATCAGAGGGCCTCTTGCAGCTGCCAACAGACAAGTGTTTGCTCGAGGATCCGTCCTTCCGTCCATATGTGGACTTGTATGC
AAAG
GTATCGTCAAAAAAAAACAAAAGCTTTTGGAAGTTTTCTGAGACTCACTCACTATAACGATACTGTGATCCAGGACGAGGACGCATTCTTCAAAGATTACGCCGAGTCTCACAAGA
AACTCTCGGAGCTGGGATGCAAGCACACCTCTCCAGCGTTTGGAAACGCAAAGGCATCGCTAGCTGTGGATTCTCACGCGAGCACTGCGACAGTACTGGCTCACAGTGCGTTTGGCCTCG
CGGTTTCAGCCATCGTCGTCGTTCTAAGCTACGCTTACGAGGTTCGCAGGAAGACTGCTCTCAAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCGGTGCCCGTCGTCGACAATGCGTACCTCAAGGCGATCGAATCCGCCAGGCGCGATCTCCGAGCTTTCATCGCCGAGAAGAATTGCGCGCCTCTGATGCTGCGATTGGCATGGCAC
GATGCTGGCACTTACGATGCCGTGTCCAAGACTGGAGGACCGAATGGCTCGATCCGGAGCGAGCGGGAGTACACTCACGCTGCCAACAATGGGCTCAAAATTGCCATTGATTTCTGTG
AG
CCTATCAAGGAGAAACACCCGACTATCACTTACGCGGATCTCTACCAG
CTAGCTGGAGTTGTGGCTGTAGAGGTAACTGGAGGACCTACGATCGATTTTGTGCCTGGCCGAAAGGATTCC
GTCGCTACTACACCAGAAGGACGACTTCCCGATGCTCATCTAG
GGGCAAAACATATCCGTGACGTGTTCTTTAGAATGGGTCTTTCTGACAAAGATATCGTCGCCCTCTCGGGAGGTCAC
ACAATA
GGAAGAGGTCACAAGGAGAGATCCGGCTTTGAGGGACCATGGACACCACAGCCATTGAAGTTCGACAATTCGTACTTCAAGGAGCTCTTGAGAGGAGAATCAGAGGGCCTCTTG
CAGCTGCCAACAGACAAGTGTTTGCTCGAGGATCCGTCCTTCCGTCCATATGTGGACTTGTATGCAAAG
GACGAGGACGCATTCTTCAAAGATTACGCCGAGTCTCACAAGAAACTCTCG
GAGCTGGGATGCAAGCACACCTCTCCAGCGTTTGGAAACGCAAAGGCATCGCTAGCTGTGGATTCTCACGCGAGCACTGCGACAGTACTGGCTCACAGTGCGTTTGGCCTCGCGGTTTCA
GCCATCGTCGTCGTTCTAAGCTACGCTTACGAGGTTCGCAGGAAGACTGCTCTCAAGTAG

Retrieve as FASTA