Entry information : ZmPrx27
Entry ID 723
Creation 2005-06-13 (Christophe Dunand)
Last sequence changes 2010-12-23 (Marie Brette (Scipio))
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-29 (Qiang Li)
Peroxidase information: ZmPrx27
Name ZmPrx27
Class Class III peroxidase    [Orthogroup: Prx153]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue types Mixed tissues
Roots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx27
start..stop
S start..stop
SbPrx70 568 0 1..342 14..352
SiPrx71 538 0 11..340 17..343
OsPrx24 457 6e-163 4..342 12..347
BdiPrx95 449 1e-159 3..340 2..344
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..225 225 N° 2 351..542 192 N° 3 695..857 163 N° 4 2626..3074 449
join(1..225,351..542,695..857,2626..3074)


exon

Literature and cross-references ZmPrx27
Literature Walbot,V., unpublished
Protein ref. UniProtKB:   B4FB95
DNA ref. GenBank:   AC196154.3 (125957..129027)
Protein sequence: ZmPrx27
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   342 (321)
PWM (Da):   %s   35522.25 (33522.1) Transmb domain:   %s   i7-29o
PI (pH):   %s   7.44 (7.44) Peptide Signal:   %s   cut: 22 range:22-342
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVVPAAPVVLGVAMVLVVLAASAGAAGQLRMGFYAESCPGVERVVGDFVRQHVRRVPTVAAALLRLHFHDCFVRGCDASVLLNSTAGSVAEKDAPPNLTLRGFDLVDRVKALVEDACPGVVSCADVLALAARDAVVAIGGPSWRVATGRRDGTVSAMQEALDDIPKHTMTFPQLASLFASKGLGVRDLVWLSGAHTIGIAHCSSFADRLYGYPGGGVGAAGNDTADPALDATYAANLRRRKCRAAGGGYAEDGVVEMDPGSHLTFDLGYYRALLKRRGLLRSDAALLTDAAARADVEGVAAGPEEVFFQLFARSMARLAALQVKTGAEGEVRRNCAVVNGG

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, 3 introns) and 39 + 6 ESTs.Containing intron shift.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGTAGTGCCGGCGGCGCCGGTGGTTCTTGGAGTGGCCATGGTGCTCGTCGTCCTGGCCGCCAGCGCCGGCGCGGCCGGGCAGCTCAGGATGGGGTTCTACGCCGAGAGCTGCCCG
GGCGTGGAGCGCGTGGTGGGCGACTTCGTCCGGCAGCACGTCCGCCGCGTGCCCACCGTCGCCGCCGCGTTGCTCCGGCTGCACTTCCACGACTGCTTCGTCAGG
GTACGTGCGTGCGTG
CGTGTGCGTGTCAGCGTGTGCGTCGTCCATTGCGTGGCGTGGTGCCAGCCTGACCGCGGGTGTGTGCATGTGTGTGATGTGTCCCACCACGCGCTCGCTCGTCCCAGCAGGGCTGCGACG
CCTCCGTCCTGCTCAACTCCACCGCCGGCAGCGTGGCCGAGAAGGACGCGCCGCCGAACCTGACGCTGCGCGGCTTCGACCTCGTCGACCGCGTCAAGGCGCTCGTCGAGGATGCCTGCC
CCGGCGTCGTCTCCTGCGCCGACGTCCTCGCGCTCGCCGCCCGGGACGCGGTCGTCGCCATC
GTGCGTGAGCTAGCTCGTCACTCCACTTTCCACCACGCCACTTCTCGATCTGGTGGTG
CCTGGACGATGGATGGATCGTCGTCGACCATGCACGTACGTACGTACGTACGAGTACGAGCTGACAACTGAGTGCGTGCTCTGGGCTCTGGCAGGGCGGGCCGTCGTGGCGCGTGGCGAC
GGGGAGGAGGGACGGCACGGTGTCCGCCATGCAGGAGGCGCTCGACGACATCCCCAAGCACACCATGACCTTCCCGCAGCTGGCCAGCCTGTTCGCCAGCAAAGGCCTCGGCGTTCGTGA
CCTCGTCTGGCTCTCAG
GTACGGTACGGTACCCTCTCCTCTACATGATTAGATCTAGAGATGGCAATGGGGACCCGATCCCCGATTTCCCGCGGGGAATTCCTCTATTAGGGGATGGGGA
TGGGAAAGTTTCTTTCCCCATGGGGATGTAAATGGGGAAAAGTTCTCCCCCGACGGGTAAACGGGGACGGGGATGAAGAAGCATTCCTCATCCCCGTTCCCCGCGGGAACCCGTTAAACT
TACATGTGACAATATTTTTATGTAATAGTTAATGATAAAAGTAAAGAATTATCTTGTCAAGAGATCACCCGTTGTACAAATACATTGATTTTAATGTGCACATAATGAATTTTACATTTA
ACAATGTGTATAAGTGACAATATTTTACATTAATAACAAATGAAATACGATTTAATTATAATTTAAGCGGGGATGGGGATCCCCGACGGGGATTTATCCTCGCGGGAACGGGGATGGGGA
AGAAATGTCCCTCGCAAGCGTTCGTGGGGATCCCCGCGGGGAATTTTTTTTGTCGCGGGGACGGGTTTGAGGAGCTAAAACCCGACGGGGAATTCCCCGTTGCCATCCCTAATTAGATCA
GTTAAAAAAAGGTTTTTTTAAATTGGTGCTCTTATAAAAAAACCCTTAAAAAAGGCATGCTTAAGTACATATCAGTAAAAAAAATTAGGGATTATTCCTGCCACTAGATCAAACGTGAGT
TTCACAAAAGTTCGATCGGAGAGGGAGATTAAAAAAACAAAAAGCCGGCCGGCTTGGTAACTCTTGAGTCTGGAGAGATCGAGGCGTAGGCCGGACACTGAGCTGAGAGAGCCTGGTTCT
GCTTGCCCATTCCTTGCATGCTGATTGGGCAACAGCAGTGCGTGCAAAAGCAGCACGAATAATGGACGCTTTCGCTGCCACTCCTATAAACAGATTCCTCGAGCACGAATGATGGGCGTC
TTGCATCAGATGCTGAATTCAATAGCCTGGCCGGGAAAAAAAATCCTTTCAGTCCTAAAAAAACATTTCTTTTCACTGTATAATTTCATATTAGTTGAGCACTGACCGTTTCTGATTCCT
CTGAAATGAGGTTCTTGAATTTAGCTCTCTTTTTTTTCACAAAAGAAAAACAGTGCAGCGCCTGAATTTTGTGTGTGCGTGTGTGCGCGCGCGCATAGGTCAGAGGTCATACTGCATTAG
CTTGTTCATTTTGACTTTTTTTTTGGGTTTTTTAAATTGGTGTCCTTAGTTTTGGCGGTGGTGTGCTCACCTATACTCTTAGTCGTGTTTTTTTACTTAGTTGTGTCTTTCTGTTCTATA
GCACTGGAAGTGCACAGCTGAGCAAAAAAACACGACCTTAATTTTTTTGGGTTTTTAAAATTGGTATCCTTAGTTTTGGTGGTGTGCTCACATATACCCTTAGTCGTGTTTTTTTGCTCA
GTTATGCTCTTCCAGTGCTATAGAACAGAAGGACACAGCTGAGAAAAAACACGATTAAGGATATAAGTGAGCACAGTAGCACACCACCAAAACTGCGCAACTTAAAAAACCTACTTTAAA
AACCTTTTTTTTCTTTTTGCTCCAAGAAATCAAGCTGTTCATCAGCAACTTGAAAGAAACCCAGCTGCCAAAAAAAAAGGCATAGAAACAAGTGTTCAATAAATCTTCCACGCAAGTGCA
GAGGCCGTTCTCTATCTAGCTAGTCTTTGCACGCGCATGCAGTCGTCCACCGCCAACTGTTTTCTAACACGTGGAGTTGAATGCCATGCCACTGATCGCGACCAGGCGCGCACACGATCG
GCATCGCGCACTGCTCCTCCTTCGCGGACCGCCTGTACGGCTACCCCGGCGGCGGCGTTGGCGCGGCCGGCAACGACACGGCCGACCCGGCCCTGGACGCGACCTACGCGGCCAACCTGC
GGAGGCGCAAGTGCCGGGCGGCGGGCGGCGGGTACGCGGAGGACGGCGTGGTGGAGATGGACCCAGGCAGCCACCTGACGTTCGACCTGGGCTACTACCGCGCGCTGCTCAAGCGCAGGG
GCCTGCTCCGCTCCGACGCCGCGCTGCTCACCGACGCGGCGGCGCGCGCCGACGTCGAGGGCGTCGCGGCCGGGCCCGAGGAGGTCTTCTTCCAGCTGTTCGCGCGGTCCATGGCCAGGC
TGGCGGCGCTGCAGGTCAAGACCGGCGCCGAGGGGGAGGTCAGGAGGAACTGCGCTGTCGTCAACGGCGGCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGTAGTGCCGGCGGCGCCGGTGGTTCTTGGAGTGGCCATGGTGCTCGTCGTCCTGGCCGCCAGCGCCGGCGCGGCCGGGCAGCTCAGGATGGGGTTCTACGCCGAGAGCTGCCCG
GGCGTGGAGCGCGTGGTGGGCGACTTCGTCCGGCAGCACGTCCGCCGCGTGCCCACCGTCGCCGCCGCGTTGCTCCGGCTGCACTTCCACGACTGCTTCGTCAGG
GGCTGCGACGCCTCC
GTCCTGCTCAACTCCACCGCCGGCAGCGTGGCCGAGAAGGACGCGCCGCCGAACCTGACGCTGCGCGGCTTCGACCTCGTCGACCGCGTCAAGGCGCTCGTCGAGGATGCCTGCCCCGGC
GTCGTCTCCTGCGCCGACGTCCTCGCGCTCGCCGCCCGGGACGCGGTCGTCGCCATC
GGCGGGCCGTCGTGGCGCGTGGCGACGGGGAGGAGGGACGGCACGGTGTCCGCCATGCAGGAG
GCGCTCGACGACATCCCCAAGCACACCATGACCTTCCCGCAGCTGGCCAGCCTGTTCGCCAGCAAAGGCCTCGGCGTTCGTGACCTCGTCTGGCTCTCAG
GCGCGCACACGATCGGCATC
GCGCACTGCTCCTCCTTCGCGGACCGCCTGTACGGCTACCCCGGCGGCGGCGTTGGCGCGGCCGGCAACGACACGGCCGACCCGGCCCTGGACGCGACCTACGCGGCCAACCTGCGGAGG
CGCAAGTGCCGGGCGGCGGGCGGCGGGTACGCGGAGGACGGCGTGGTGGAGATGGACCCAGGCAGCCACCTGACGTTCGACCTGGGCTACTACCGCGCGCTGCTCAAGCGCAGGGGCCTG
CTCCGCTCCGACGCCGCGCTGCTCACCGACGCGGCGGCGCGCGCCGACGTCGAGGGCGTCGCGGCCGGGCCCGAGGAGGTCTTCTTCCAGCTGTTCGCGCGGTCCATGGCCAGGCTGGCG
GCGCTGCAGGTCAAGACCGGCGCCGAGGGGGAGGTCAGGAGGAACTGCGCTGTCGTCAACGGCGGCTAA

Retrieve as FASTA