Entry information : CriCIIBB01 (mnpB)
Entry ID 7274
Creation 2010-02-26 (Marcel Zamocky)
Last sequence changes 2011-10-21 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2012-10-29 (Nizar Fawal)
Peroxidase information: CriCIIBB01 (mnpB)
Name (synonym) CriCIIBB01 (mnpB)
Class Other class II peroxidase type B    [Orthogroup: CIIBB001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Ceriporiopsis
Organism Ceriporiopsis rivulosa    [TaxId: 75794 ]
Cellular localisation Secreted
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CriCIIBB01
start..stop
S start..stop
CsuCIIBB03 634 0 1..363 1..363
GsppCIIBB07 540 0 1..363 1..365
TvCIIBB15_KN9522 524 0 1..363 1..364
HanCIIBB07 522 0 1..363 1..361
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..401 401 N° 2 460..527 68 N° 3 581..592 12 N° 4 647..764 118
N° 5 820..1015 196 N° 6 1067..1112 46 N° 7 1162..1399 238 N° 8 1453..1465 13
join(1..401,460..527,581..592,647..764,820..1015,1067..1112,1162..1399,1453..146 5)


exon

Literature and cross-references CriCIIBB01 (mnpB)
Literature Hakala T.K., Hilden K., Maijala P., Olsson C., Hatakka A. Differential regulation of manganese peroxidases and characterization of two variable MnP encoding genes in the white-rot fungus Physisporinus rivulosus. Appl. Microbiol. Biotechnol. 73:839-849(2006)
Protein ref. GenBank:   ABB83813 UniProtKB:   A0ELU2
DNA ref. GenBank:   DQ249812.1
Protein sequence: CriCIIBB01 (mnpB)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   363 (343)
PWM (Da):   %s   37782.74 (35731.6)  
PI (pH):   %s   4.26 (4.17) Peptide Signal:   %s   cut: 21 range:21-363
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKSLAALVTLLSIQAVHGAITRRVTCPDGVNTATNAACCPLFAVRDDIQEFLFDGGKCGEEVHESLRLTFHDAIGFSPSLTAQGTFGGGGADGSIATFESIETAYHANTGIDEIINEQAPFIVKHNMTAGDFIQFAGAVGVSNCAGAPRLEFLGRPPATAPAPDKTVPEPFDTVDSILARFADAGFSPQEVIALLASHSVAAADHVDPAIPGTPFDSTPSDFDSQIFIEVQLRGTLFPGTGGNQGEVESPYPGEIRLQSDHLARDSRTACFWQALANDQAQIQAQFKAAMAKLAVVGQDVSQMVDCSEVIPVPAPPATTPHIPAGLSQNNIEQACATAAFPTLPVDVGPQTSILPVPAS

Retrieve as FASTA  
Remarks Complete sequence from genomic. Strain="DSM 14618".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCAAGTCTCTCGCTGCCCTCGTTACTCTCTTGTCGATTCAAGCCGTTCATGGAGCGATCACTCGACGAGTAACATGCCCCGACGGTGTGAACACAGCGACAAACGCTGCATGC
TGCCCGCTTTTTGCTGTACGCGACGACATCCAGGAGTTCCTCTTCGACGGCGGAAAGTGCGGCGAAGAGGTCCATGAATCGCTCCGCCTGACCTTCCACGACGCAATCGGTTTCTCGCCC
TCGCTCACTGCTCAGGGCACCTTTGGTGGAGGTGGTGCAGACGGCTCAATCGCGACCTTCGAGAGCATTGAGACAGCCTACCACGCAAACACTGGCATTGACGAGATCATCAACGAGCAG
GCGCCGTTCATCGTGAAGCATAACATGACTGCGGGTGACTT
GTAAGCAACTAGTTTGTACAGCGATGAAGATTTACTCACTGATTGTTTGTATATATAGCATTCAGTTCGCTGGTGCGGT
CGGTGTAAGTAATTGTGCCGGTGCTCCGCGACTCGAGTTTTTGCTAG
GTACGAATCGCATCTTCAAATGTACTCATAGGAGACTAACATTACTTGTACAGGACGCCCCCCAGGTTCGGTC
ACGTCGTCATTCCTCAAGTACCTAGACTGACCTTGAGGCTCACTAGCTACAGCCCCCGCGCCCGACAAGACTGTTCCCGAGCCGTTCGACACCGTCGACAGCATTCTCGCCCGCTTTGCT
GATGCTGGATTCAGCCCGCAGGAGGTCATTGCGCTCCTCGCCTC
GTAGGTCTAACCAAACTCGTAGCACATCGTGTTTAAAACCGACACTATCCTACAGACACAGCGTCGCCGCGGCTGA
CCACGTCGACCCAGCCATTCCTGGCACACCCTTCGACTCGACGCCGTCTGATTTCGACTCGCAGATCTTCATTGAGGTCCAGCTCCGAGGCACCCTCTTCCCGGGTACTGGAGGCAATCA
AGGCGAGGTTGAGTCTCCGTACCCTGGTGAGATCCGGCTGCAGTCCGATCACACG
GTATGTCGTTGCCTTTCCTTTCGAACCGGCCATCCTGACCAGGTCCTATAGCTCGCGCGTGACTC
ACGCACGGCGTGCTTCTGGCAAGCCCTCGCCA
GTGAGTGAACATTCTGGTTTCTGCTATGCCTCACCTAACGTCGCCACAGACGACCAGGCACAGATTCAGGCCCAATTTAAGGCCGCAA
TGGCGAAGCTCGCCGTTGTCGGACAGGACGTGTCGCAGATGGTCGATTGTTCCGAGGTAATTCCCGTGCCTGCGCCGCCAGCCACGACTCCGCACATCCCCGCCGGTCTGTCCCAGAACA
ACATTGAGCAGGCCTGCGCCACCGCGGCGTTCCCCACACTCCCGGTCGACGTTGGGCCGCAGACCTCCATCCTGCCTGT
GTAAGTGCTGGAGAGCTCACCTATGACCGTTCACTGATGGG
TGTGTTTTCCAGTCCCGCCTCGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCAAGTCTCTCGCTGCCCTCGTTACTCTCTTGTCGATTCAAGCCGTTCATGGAGCGATCACTCGACGAGTAACATGCCCCGACGGTGTGAACACAGCGACAAACGCTGCATGC
TGCCCGCTTTTTGCTGTACGCGACGACATCCAGGAGTTCCTCTTCGACGGCGGAAAGTGCGGCGAAGAGGTCCATGAATCGCTCCGCCTGACCTTCCACGACGCAATCGGTTTCTCGCCC
TCGCTCACTGCTCAGGGCACCTTTGGTGGAGGTGGTGCAGACGGCTCAATCGCGACCTTCGAGAGCATTGAGACAGCCTACCACGCAAACACTGGCATTGACGAGATCATCAACGAGCAG
GCGCCGTTCATCGTGAAGCATAACATGACTGCGGGTGACTT
CATTCAGTTCGCTGGTGCGGTCGGTGTAAGTAATTGTGCCGGTGCTCCGCGACTCGAGTTTTTGCTAGGACGCCCCCCA
G
CTACAGCCCCCGCGCCCGACAAGACTGTTCCCGAGCCGTTCGACACCGTCGACAGCATTCTCGCCCGCTTTGCTGATGCTGGATTCAGCCCGCAGGAGGTCATTGCGCTCCTCGCCTCA
CACAGCGTCGCCGCGGCTGACCACGTCGACCCAGCCATTCCTGGCACACCCTTCGACTCGACGCCGTCTGATTTCGACTCGCAGATCTTCATTGAGGTCCAGCTCCGAGGCACCCTCTTC
CCGGGTACTGGAGGCAATCAAGGCGAGGTTGAGTCTCCGTACCCTGGTGAGATCCGGCTGCAGTCCGATCACACG
CTCGCGCGTGACTCACGCACGGCGTGCTTCTGGCAAGCCCTCGCC
A
ACGACCAGGCACAGATTCAGGCCCAATTTAAGGCCGCAATGGCGAAGCTCGCCGTTGTCGGACAGGACGTGTCGCAGATGGTCGATTGTTCCGAGGTAATTCCCGTGCCTGCGCCGCCA
GCCACGACTCCGCACATCCCCGCCGGTCTGTCCCAGAACAACATTGAGCAGGCCTGCGCCACCGCGGCGTTCCCCACACTCCCGGTCGACGTTGGGCCGCAGACCTCCATCCTGCCTGT
T
CCCGCCTCGTAG

Retrieve as FASTA