Entry information : HanCIIBB04 (MnP04)
Entry ID 7275
Creation 2010-02-26 (Marcel Zamocky)
Last sequence changes 2012-04-02 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-06-01 (Catherine Mathe)
Peroxidase information: HanCIIBB04 (MnP04)
Name (synonym) HanCIIBB04 (MnP04)
Class Other class II peroxidase type B    [Orthogroup: CIIBB001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Bondarzewiaceae Heterobasidion
Organism Heterobasidion annosum (root rot fungus)    [TaxId: 13563 ]
Cellular localisation Secreted
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HanCIIBB04
start..stop
S start..stop
HanCIIBB07 513 0 1..357 1..361
HanCIIBB02 508 0 1..357 1..356
PcriCIIBB07 489 3e-175 1..357 1..359
PoVP04_PC15 489 7e-175 3..357 6..357
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2329682..2329733 52 N° 2 2329424..2329619 196 N° 3 2329237..2329371 135 N° 4 2329059..2329180 122
N° 5 2328921..2328996 76 N° 6 2328732..2328857 126 N° 7 2328592..2328671 80 N° 8 2328501..2328536 36
N° 9 2328275..2328447 173 N° 10 2328143..2328207 65 N° 11 2328071..2328083 13  
complement(join(2328071..2328083,2328143..2328207,2328275..2328447,2328501..2328 536,2328592..2328671,2328732..2328857,2328921..2328996,2329059..2329180,2329237. .2329371,2329424..2329619,2329682..2329733))


exon

Literature and cross-references HanCIIBB04 (MnP04)
Literature JGI genome project
DNA ref. JGI genome:   scaffold_5 (2329733..2328071)
mRNA ref. JGI transcript:   5979
Protein sequence: HanCIIBB04 (MnP04)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   357 (339)
PWM (Da):   %s   38073.44 (36283.4)  
PI (pH):   %s   4.33 (4.25) Peptide Signal:   %s   cut: 19 range:19-357
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALKIVAILVAFVGVAHGAVTRRVTCPDGVNTATNEVCCPLFTIREDIQKHLFDGGECGEEVHESLRLTFHDAIGYSNTRNVGSGGADGSIVVFSEREMTYAANNGIEDIIESQKPFIAKHNISAGDFVQFAGAVGVSNCPGAPRLEFMFGRPDPVAPADDLTVPEPHSVDQILARFDDAGFNPDEVVALLASHSVAGADNVDETIPGTPFDSTPSSFDTQFFIETQLHGTQWPGVGNNKGEVQSPMGGEMRLQSDAALADPRTACAWQDLAAQQSKMMAAFRDAMAKMAILGQDRSQLVDCSEVIPDPQPVKNRPHYPAGFDINDIEQCDAQPYPALATDPGPKTAVSPVPPS

Retrieve as FASTA  
Remarks Complete sequence from genomic (10 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTGAAGATTGTTGCTATCCTCGTCGCCTTCGTGGGTGTCGCTCATGGTGAGCGCCAGTTGCACTGAGGACACCAGGTTCGAGCTTAAGCGGACGCAACATATCTACAGGCGCTG
TCACCCGACGGGTAACTTGCCCTGACGGCGTCAATACAGCTACGAACGAGGTCTGCTGCCCTCTCTTCACGATTCGGGAGGATATCCAAAAGCACCTGTTCGACGGTGGAGAGTGCGGCG
AGGAGGTGCACGAGTCGCTTCGTCTGACATTCCATGACGCTATTGGTTACTCGAATACGAGAAACGTCGG
GTAGGTGGCTTCGTGCTGTGTACCTTCCTTCCTGTTCTAAGGGCACCATC
AGCAGTGGAGGTGCTGATGGCTCGATTGTCGTCTTCTCCGAACGTGAGATGACGTACGCGGCCAATAATGGCATCGAAGACATCATCGAGTCGCAGAAGCCGTTCATCGCCAAGCACAAC
ATATCCGCGGGTGACTT
GTATGTGTCGTTCCTGTCTCGATCGGGCCCGCGGTCTAACGTGCGCCTCTCGTCAGCGTTCAATTTGCCGGCGCCGTCGGCGTGTCTAACTGCCCTGGCGCCC
CCCGCCTGGAGTTCATGTTCGGCCGTCCCGACCCCGTCGCCCCCGCCGACGACCTCACGGTCCCTGAGCCTTTCC
GCAAGCACATGTTTCCTGATTGTCCGGCGAGCTTGGAATTGATAA
TCTGGCCCTCTTTCTAGACTCGGTTGATCAGATTCTGGCCCGCTTCGACGATGCAGGTTTCAATCCCGACGAGGTCGTAGCTCTGCTTGCGTCGTGAGTGTCACGTCACTCGCCCAACCA
TGCTAACGGTGTTGACCGCGAGAACTCATTCCATAGTCACTCCGTAGCGGGCGCCGACAACGTCGACGAGACCATCCCCGGCACGCCCTTTGACTCTACCCCAAGTTCATTCGATACTCA
ATTCTTTATCGAGACTCAGCTCCATGGTACTCAGTGGCCGGG
GTACGCTGTCCTCTTACTAATATCTGCTGTGCGGCAGCTGAGCGACTGAAACCGATTCAGAGTGGGAAACAACAAGGG
TGAGGTCCAGTCCCCTATGGGTGGTGAGATGCGTCTTCAGTCCGATGCGGCCTTGGCAAGAG
GTCAGTTGCAACGCCTTTATTTGAAGCTTTGATCACCGGCTAACGTTCCAGGAAGACC
CTCGCACAGCATGCGCTTGGCAAGACCTCGCTG
GTTAGTATTGTCTTCTCCCATCTAGGCATCGTCTGATAGACATCTCCAAACAGCCCAGCAATCCAAGATGATGGCCGCATTCAGAGA
TGCAATGGCTAAGATGGCCATCCTAGGCCAAGACAGAAGTCAACTGGTGGATTGCTCGGAGGTCATCCCGGACCCTCAGCCGGTGAAGAACAGGCCTCATTACCCCGCTGGGTTTGACAT
CAACGATATCGAACAAATG
GTGCGTATATGATCCTGTTCATTGAACTTCCCTGTCGCTCCTTAGCTAATATATGCACCTACAATAGTGCGATGCGCAACCCTACCCGGCGCTCGCCACGG
ATCCTGGCCCAAAAACCGCGGTATCTCCTGT
GTAAGCTGCCTCCCGTTCGTATGTTGACTCGGGTTGCTGAATCTGCCTCAATACTGCAGCCCTCCATCTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTGAAGATTGTTGCTATCCTCGTCGCCTTCGTGGGTGTCGCTCATGGCGCTGTCACCCGACGGGTAACTTGCCCTGACGGCGTCAATACAGCTACGAACGAGGTCTGCTGCCCT
CTCTTCACGATTCGGGAGGATATCCAAAAGCACCTGTTCGACGGTGGAGAGTGCGGCGAGGAGGTGCACGAGTCGCTTCGTCTGACATTCCATGACGCTATTGGTTACTCGAATACGAGA
AACGTCGG
CAGTGGAGGTGCTGATGGCTCGATTGTCGTCTTCTCCGAACGTGAGATGACGTACGCGGCCAATAATGGCATCGAAGACATCATCGAGTCGCAGAAGCCGTTCATCGCCAAG
CACAACATATCCGCGGGTGACTT
CGTTCAATTTGCCGGCGCCGTCGGCGTGTCTAACTGCCCTGGCGCCCCCCGCCTGGAGTTCATGTTCGGCCGTCCCGACCCCGTCGCCCCCGCCGAC
GACCTCACGGTCCCTGAGCCTTTCC
ACTCGGTTGATCAGATTCTGGCCCGCTTCGACGATGCAGGTTTCAATCCCGACGAGGTCGTAGCTCTGCTTGCGTCTCACTCCGTAGCGGGCGCC
GACAACGTCGACGAGACCATCCCCGGCACGCCCTTTGACTCTACCCCAAGTTCATTCGATACTCAATTCTTTATCGAGACTCAGCTCCATGGTACTCAGTGGCCGGG
AGTGGGAAACAAC
AAGGGTGAGGTCCAGTCCCCTATGGGTGGTGAGATGCGTCTTCAGTCCGATGCGGCCTTGGCAAGAG
ACCCTCGCACAGCATGCGCTTGGCAAGACCTCGCTGCCCAGCAATCCAAGATG
ATGGCCGCATTCAGAGATGCAATGGCTAAGATGGCCATCCTAGGCCAAGACAGAAGTCAACTGGTGGATTGCTCGGAGGTCATCCCGGACCCTCAGCCGGTGAAGAACAGGCCTCATTAC
CCCGCTGGGTTTGACATCAACGATATCGAACAAATG
TGCGATGCGCAACCCTACCCGGCGCTCGCCACGGATCCTGGCCCAAAAACCGCGGTATCTCCTGTCCCTCCATCTTAG

Retrieve as FASTA