Entry information : HanCIIBA01 (MnP03b / gpx1)
Entry ID 7276
Creation 2010-02-27 (Marcel Zamocky)
Last sequence changes 2011-09-15 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-02-02 (Christophe Dunand)
Peroxidase information: HanCIIBA01 (MnP03b / gpx1)
Name (synonym) HanCIIBA01 (MnP03b / gpx1)
Class Other class II peroxidase type A    [Orthogroup: CIIBA001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Bondarzewiaceae Heterobasidion
Organism Heterobasidion annosum (root rot fungus)    [TaxId: 13563 ]
Cellular localisation Secreted
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HanCIIBA01
start..stop
S start..stop
PcriCIIBB05 372 6e-129 1..344 1..342
PoVP04_PC15 370 3e-128 1..346 1..343
PoVP04_PC9 369 5e-128 1..346 1..343
HanCIIBB04 360 2e-124 1..346 1..343
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 472344..472404 61 N° 2 472478..472667 190 N° 3 472772..472912 141 N° 4 472981..473102 122
N° 5 473158..473233 76 N° 6 473299..473424 126 N° 7 473498..473580 83 N° 8 473643..473678 36
N° 9 473740..473912 173 N° 10 473973..474011 39  
join(472344..472404,472478..472667,472772..472912,472981..473102,473158..473233, 473299..473424,473498..473580,473643..473678,473740..473912,473973..474011)


exon

Literature and cross-references HanCIIBA01 (MnP03b / gpx1)
Literature Stenlid J. (2010) What have we learnt about pathogenicity from sequencing the Heterobasidion genome? ECFG-10 abstract book p.16; JGI genome draft.
DNA ref. JGI genome:   scaffold_06 (472344..474011)
EST ref. GenBank:   GR744426.1 [5' end]   GR734476.1 [3' end]
Cluster/Prediction ref. JGI gene:   181069
Protein sequence: HanCIIBA01 (MnP03b / gpx1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   348 (327)
PWM (Da):   %s   37345.07 (35123.9)  
PI (pH):   %s   4.32 (4.27) Peptide Signal:   %s   cut: 22 range:22-348
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFNIPTLLFAAFAFSSLAHAAITPRVECADGSITTNKACCPLFSLRDQLQRDFFEGECDFESRGSLRLAFHDAVGYSLSNPNGGGGADGSIMQFASIENAYDANLGIDEIVNAQLQFLATHNVSLSYGDFIQFASAVGLTNCPGAPTLDFYLGRPDAKAAAPDDTVPEPHTPDIILARMADVGFTPNEVVALLASHTMATSKEVDETIAALPFDSTPATFDTQFYLESLLNGTMYPGADGKNFGQEMSPFGGVIRITSDYLLADSRTACQWQGMIKNQSRMQSAFKAAMKKLSLVGQNELSLIDCSEVILPAARVNDSPHFPHGTSEKDVDQCNMPFPDLPTTA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (9 introns), and 9 ESTs (confirm the short 3'end). Strain="TC 32-1".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTCAACATCCCCACTCTCCTTTTCGCTGCATTCGCTTTTTCGTCGCTCGCTCATGGTGCGTACAGGGAACCGTTTCAACTTCCCTTCCACGAATTCGAGACCGTTGACGCGAGC
GGAATGCTCAACAGCTGCAATCACCCCCCGCGTCGAATGCGCCGACGGTAGCATCACCACGAACAAGGCGTGCTGTCCGCTCTTCAGCCTCCGCGACCAGCTCCAGCGCGACTTTTTCGA
GGGGGAGTGCGACTTCGAGTCCCGCGGATCCCTCCGCCTCGCTTTCCATGACGCTGTCGGATATTCTCTGTCGAATCCAAATGG
GTGCGTCCACGCCGGCCCCCTTCAGTCATCTTGCGG
TGGGTTCTGATCGATCAACACCGTCACACTGCTCGGCTCGACTACACCTACCCCGCGGCCAAATTCAGCGGCGGAGGCGCCGACGGTTCCATCATGCAGTTCGCATCAATCGAGAACGCG
TACGATGCCAACCTCGGTATCGACGAGATCGTCAACGCGCAGCTGCAGTTCCTCGCGACACACAATGTGTCCCTCAGCTACGGTGACTT
GTGTGTATACCCTGTCCGCGCCATCCATGTT
CGATTTATTGAGTGACATGACCATGCGTGCTGTCTAGTATCCAGTTTGCAAGTGCCGTAGGGCTGACCAACTGTCCTGGCGCACCTACACTCGATTTCTATCTCGGACGCCCGGACGCCA
AGGCTGCTGCTCCGGATGACACTGTCCCGGAGCCCTTCC
GTTCGTCCGCCTCGCATTCCGGCGCCGACAGGGCTTAACTGAACAACCTGCACAGACACGCCCGATATCATTCTGGCCCGC
ATGGCCGATGTGGGATTCACCCCGAATGAGGTCGTCGCTCTGCTTGCCTC
GTGAGTCCACGTCTAAAAACGTGCAGGTGAAAAGGTCTGATGTGTTGGACGCGGCGATCTGCAAGGCACA
CAATGGCAACATCAAAGGAAGTCGACGAAACAATTGCCGCGCTGCCCTTTGATTCGACGCCCGCGACGTTCGACACGCAGTTCTACCTCGAGTCGCTGCTGAACGGTACCATGTATCCTG
G
GTTCGTGCATTCTTATCCCTCCAGCAGAAAAACGAAATTGTAGCTGACGGGGCTTCGCGATGGGTGACTGTAGGGCTGATGGTAAAAATTTCGGTCAAGAGATGTCTCCCTTTGGCGGC
GTGATCCGCATCACATCCGATTATCTGCTAGCAAGGG
GTACGTCTGCATCTGTGCAAATGCAGGGACCTCTTAAAATCGCGACTCACCTTGCGAACCAGATTCGCGCACAGCGTGTCAAT
GGCAAGGAATGATCA
GTGCGTCGTGTTGTCTTGTGGAACAGAATGAGATCAGATAAGTGCTGATCTCCTGTCACAGAGAACCAATCGCGGATGCAGTCTGCGTTCAAAGCCGCGATGAAG
AAGCTCTCGCTTGTCGGGCAGAATGAGCTCAGCCTCATCGACTGCTCTGAGGTCATCCTGCCTGCCGCGCGCGTCAATGACAGCCCACATTTCCCGCATGGCACGTCGGAGAAGGATGTT
GATCAATCG
GTGCGTGCGCACCTCTGCGCGCGTCTGCTCTGGTATCTGACTGAGCGACTTGCGAAACAGTGCAATATGCCGTTCCCGGACTTGCCCACCACAGCCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTCAACATCCCCACTCTCCTTTTCGCTGCATTCGCTTTTTCGTCGCTCGCTCATGCTGCAATCACCCCCCGCGTCGAATGCGCCGACGGTAGCATCACCACGAACAAGGCGTGC
TGTCCGCTCTTCAGCCTCCGCGACCAGCTCCAGCGCGACTTTTTCGAGGGGGAGTGCGACTTCGAGTCCCGCGGATCCCTCCGCCTCGCTTTCCATGACGCTGTCGGATATTCTCTGTCG
AATCCAAATGG
CGGCGGAGGCGCCGACGGTTCCATCATGCAGTTCGCATCAATCGAGAACGCGTACGATGCCAACCTCGGTATCGACGAGATCGTCAACGCGCAGCTGCAGTTCCTCGCG
ACACACAATGTGTCCCTCAGCTACGGTGACTT
TATCCAGTTTGCAAGTGCCGTAGGGCTGACCAACTGTCCTGGCGCACCTACACTCGATTTCTATCTCGGACGCCCGGACGCCAAGGCT
GCTGCTCCGGATGACACTGTCCCGGAGCCCTTCC
ACACGCCCGATATCATTCTGGCCCGCATGGCCGATGTGGGATTCACCCCGAATGAGGTCGTCGCTCTGCTTGCCTCGCACACAATG
GCAACATCAAAGGAAGTCGACGAAACAATTGCCGCGCTGCCCTTTGATTCGACGCCCGCGACGTTCGACACGCAGTTCTACCTCGAGTCGCTGCTGAACGGTACCATGTATCCTGG
GGCT
GATGGTAAAAATTTCGGTCAAGAGATGTCTCCCTTTGGCGGCGTGATCCGCATCACATCCGATTATCTGCTAGCAAGGG
ATTCGCGCACAGCGTGTCAATGGCAAGGAATGATCAAGAAC
CAATCGCGGATGCAGTCTGCGTTCAAAGCCGCGATGAAGAAGCTCTCGCTTGTCGGGCAGAATGAGCTCAGCCTCATCGACTGCTCTGAGGTCATCCTGCCTGCCGCGCGCGTCAATGAC
AGCCCACATTTCCCGCATGGCACGTCGGAGAAGGATGTTGATCAATCG
TGCAATATGCCGTTCCCGGACTTGCCCACCACAGCCTAA

Retrieve as FASTA