Entry information : ZmPrx32(Peroxidase 40/ GRMZM2G033985)
Entry ID 728
Creation 2007-11-15 (Christophe Dunand)
Last sequence changes 2010-12-23 (Marie Brette (Scipio))
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2019-07-08 (Christophe Dunand)
Peroxidase information: ZmPrx32(Peroxidase 40/ GRMZM2G033985)
Name ZmPrx32(Peroxidase 40/ GRMZM2G033985)
Class Class III peroxidase    [Orthogroup: Prx027]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue types Mixed tissues
Pollens
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx32
start..stop
S start..stop
SbPrx103 614 0 1..368 1..371
SiPrx68 566 0 1..368 1..358
TaPrx22-1A 520 0 27..366 22..348
BdiPrx105 515 0 7..366 5..368
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 45703359..45703670 312 N° 2 45703802..45703993 192 N° 3 45704170..45704335 166 N° 4 45704435..45704874 440
join(45703359..45703670,45703802..45703993,45704170..45704335,45704435..45704874 )


exon

Literature and cross-references ZmPrx32(Peroxidase 40/ GRMZM2G033985)
Literature Hainey,C.F. et al., unpublished
Protein ref. UniProtKB:   B4FTQ3
DNA ref. GenBank:   AC195314.2 (106600..108112)
mRNA ref. GenBank:   AY109094
Cluster/Prediction ref. UniGene:   Zm.81309
Protein sequence: ZmPrx32(Peroxidase 40/ GRMZM2G033985)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   369 (349)
PWM (Da):   %s   37676.01 (35638.8) Transmb domain:   %s   i7-29o
PI (pH):   %s   5.39 (5.17) Peptide Signal:   %s   cut: 21 range:21-369
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAHSTTLALVIVVVLALTFGATVSVSAPVNKSCVSGSAGASVSIGYGGARASAGAGVSLGADAYRSTCPRAEEIIRAAVERAVAADPRMAASLLRLHFHDCFVNGCDGSVLLDDKPFFIGEKTAVPNANSIRGFEVIDAIKTELERECPDTVSCADLLAIAARDSVVVSGGPSWEIEVGRKDSRTASLQGANTNLPAPTSGVDTLVQKFRNVGLSTKDMVALSGAHTIGKARCTSFSARLAGAGGVSEGGAGAFKDLTFLQSLQQLCTGSAGSALAHLDLATPATFDNQYYINLLSGDGLLPSDQALASSAAVPGVEADVASLVATYAFDASVFFQDFAESMLRMGRLAPGVGTSGEVRRNCRVVNSSE

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 3 introns) and 120 ESTs. Also found in AC229886.4.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCACTCCACCACCTTGGCCCTGGTGATTGTCGTTGTGCTGGCGCTCACCTTTGGTGCCACGGTCAGTGTCTCCGCTCCCGTGAACAAGTCGTGCGTCAGCGGTAGCGCCGGCGCC
AGCGTGAGCATTGGCTACGGCGGGGCAAGAGCCAGCGCCGGCGCTGGCGTGTCCCTTGGCGCCGACGCGTACCGGAGCACGTGCCCCCGTGCCGAGGAGATCATCCGTGCGGCCGTTGAG
AGGGCCGTCGCTGCCGACCCACGCATGGCAGCGTCTCTCCTGCGCCTCCATTTCCATGACTGCTTCGTCAAC
GTAATATTTGTTGATCGATCGAGCTCCTCCCGCTCCCGCCCACTCGAC
CATCCACACCCACACACATGCATATGGTCATTATGCATTGTATATATTCGGTGACTTGTTTTAACTAATTATCTCTCGGCCAGGGCTGTGACGGCTCCGTTCTTCTGGACGACAAGCCGT
TCTTCATCGGCGAGAAGACGGCTGTGCCCAACGCCAACTCAATCAGGGGCTTCGAGGTCATTGACGCCATCAAGACCGAGCTGGAGCGGGAGTGCCCAGATACAGTTTCCTGTGCCGACC
TCCTTGCCATCGCTGCCCGTGACTCCGTCGTTGTG
GTATGTATTACATACATAGGCATCATCGTCTCATCGACACTTATAATAAGCTTCTTCTCAATCACATAGATCTTCTTTTGAAGTC
GTGCAAATAAAAAGATTGTTCTACTGAGTAATGCATGATCATGGTTTGTTTGCATCATCATCATCATTAAATTATCCGGCGGCCCGTTCAGTCTGGCGGGCCGAGCTGGGAGATTGAGGT
CGGCCGGAAGGACAGCCGCACCGCCAGCCTGCAGGGCGCCAACACCAACCTCCCAGCACCGACGTCTGGCGTCGACACCCTCGTGCAGAAGTTCAGGAACGTGGGCCTCTCTACCAAGGA
CATGGTCGCACTCTCCG
GTAATAATTAGGAATCTCTGCATACTCGGCAGGCACACATGCTTGTTCGTACGTATACACTAAATATACCACTACTAATACACATGATTATATACACAGGCGC
GCACACCATCGGGAAAGCGCGGTGCACTTCGTTCAGTGCGCGCCTTGCCGGCGCCGGCGGCGTCTCGGAAGGCGGCGCGGGCGCCTTCAAGGACCTCACCTTCTTGCAGTCGCTGCAGCA
GCTGTGCACGGGGTCGGCTGGGTCCGCGCTGGCACACCTGGACCTCGCCACCCCGGCGACCTTCGACAACCAGTACTACATCAACCTGCTCTCTGGCGACGGTCTGCTGCCGTCAGACCA
GGCACTGGCGTCGTCGGCTGCCGTGCCTGGGGTAGAGGCGGACGTCGCCAGCCTCGTCGCCACCTACGCCTTCGACGCCTCCGTATTCTTCCAGGACTTCGCGGAGTCCATGCTGCGGAT
GGGGAGGCTTGCACCGGGCGTCGGCACCAGCGGCGAGGTCCGCCGGAACTGCCGGGTGGTGAACAGCTCCGAATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCACTCCACCACCTTGGCCCTGGTGATTGTCGTTGTGCTGGCGCTCACCTTTGGTGCCACGGTCAGTGTCTCCGCTCCCGTGAACAAGTCGTGCGTCAGCGGTAGCGCCGGCGCC
AGCGTGAGCATTGGCTACGGCGGGGCAAGAGCCAGCGCCGGCGCTGGCGTGTCCCTTGGCGCCGACGCGTACCGGAGCACGTGCCCCCGTGCCGAGGAGATCATCCGTGCGGCCGTTGAG
AGGGCCGTCGCTGCCGACCCACGCATGGCAGCGTCTCTCCTGCGCCTCCATTTCCATGACTGCTTCGTCAAC
GGCTGTGACGGCTCCGTTCTTCTGGACGACAAGCCGTTCTTCATCGGC
GAGAAGACGGCTGTGCCCAACGCCAACTCAATCAGGGGCTTCGAGGTCATTGACGCCATCAAGACCGAGCTGGAGCGGGAGTGCCCAGATACAGTTTCCTGTGCCGACCTCCTTGCCATC
GCTGCCCGTGACTCCGTCGTTGTG
TCTGGCGGGCCGAGCTGGGAGATTGAGGTCGGCCGGAAGGACAGCCGCACCGCCAGCCTGCAGGGCGCCAACACCAACCTCCCAGCACCGACGTCT
GGCGTCGACACCCTCGTGCAGAAGTTCAGGAACGTGGGCCTCTCTACCAAGGACATGGTCGCACTCTCCG
GCGCGCACACCATCGGGAAAGCGCGGTGCACTTCGTTCAGTGCGCGCCTT
GCCGGCGCCGGCGGCGTCTCGGAAGGCGGCGCGGGCGCCTTCAAGGACCTCACCTTCTTGCAGTCGCTGCAGCAGCTGTGCACGGGGTCGGCTGGGTCCGCGCTGGCACACCTGGACCTC
GCCACCCCGGCGACCTTCGACAACCAGTACTACATCAACCTGCTCTCTGGCGACGGTCTGCTGCCGTCAGACCAGGCACTGGCGTCGTCGGCTGCCGTGCCTGGGGTAGAGGCGGACGTC
GCCAGCCTCGTCGCCACCTACGCCTTCGACGCCTCCGTATTCTTCCAGGACTTCGCGGAGTCCATGCTGCGGATGGGGAGGCTTGCACCGGGCGTCGGCACCAGCGGCGAGGTCCGCCGG
AACTGCCGGGTGGTGAACAGCTCCGAATAA

Retrieve as FASTA