Entry information : OsPrx[P]81 (Os06g33090)
Entry ID 7282
Creation 2010-03-04 (Christophe Dunand)
Last sequence changes 2010-07-16 (Christophe Dunand)
Sequence status partial
Reviewer Qiang Li
Last annotation changes 2012-08-13 (Qiang Li)
Peroxidase information: OsPrx[P]81 (Os06g33090)
Name (synonym) OsPrx[P]81 (Os06g33090)
Class Class III peroxidase     [Orthogroup: Prx151]*
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx[P]81
start..stop
S start..stop
OsPrx81 484 2e-175 1..246 83..328
OsPrx82 463 1e-166 1..246 83..328
OsPrx85 326 4e-113 1..248 72..316
OsPrx84 315 2e-108 1..246 80..321
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 18917871..18918602 732 N° 2 18916879..18916920 42  
complement(join(18916879..18916920,18917871..18918602))


exon

Literature and cross-references OsPrx[P]81 (Os06g33090)
Protein ref. UniProtKB:   Q654F4
DNA ref. GenBank:   NC_008399.1 (18918602..18916882)
Protein sequence: OsPrx[P]81 (Os06g33090)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   257
PWM (Da):   %s   28157.68  
PI (pH):   %s   4.66
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GCDASILLNATDSMESEKDAEPNATLAGFDVIDGIKSELERSCPATVSCADVLALAARDAVAMLSGPSWGVLLGRKDSLTASIDMANKDLPNPKDSLAELIRMFEKNGLDERDLTALSGAHTVGMAHDCKNYDDRIYSRVGQGGDSIDPSFAAQRRQECEQKHGNATAPFDERTPAKFDNAYYIDLLARRGLLTSDQELYTQGCETGDLVKTYAMNGDVFFADFVRAMVKMGNIRPKHWWTPAEVRYSRLETIYRCT*

Retrieve as FASTA  
Remarks Partial sequence from genomic (chromo 6, no intron). Exon 1 is missing. UniProt entry not identical with this complete sequence
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGTTGTGATGCCTCCATCCTTCTGAACGCTACGGACTCCATGGAGAGCGAGAAGGATGCCGAGCCCAACGCCACCCTCGCCGGCTTCGACGTGATCGACGGCATCAAGTCCGAGCTCGAG
CGCAGCTGCCCGGCCACCGTCTCCTGCGCCGATGTTCTCGCGCTCGCCGCCCGCGACGCCGTCGCGATGCTCAGCGGGCCCAGCTGGGGCGTGCTCCTCGGCCGCAAGGACTCCCTCACC
GCCAGCATAGACATGGCCAACAAGGATCTCCCGAACCCGAAAGACAGCCTGGCCGAACTCATCAGGATGTTCGAGAAGAACGGCCTCGACGAACGCGACCTCACCGCGCTCTCCGGTGCG
CACACCGTCGGCATGGCACATGACTGCAAGAACTACGACGACCGCATCTACAGCCGCGTCGGCCAGGGCGGCGACAGCATCGACCCATCCTTCGCGGCGCAACGCCGGCAGGAATGCGAG
CAGAAGCACGGCAACGCCACTGCGCCGTTCGACGAGCGGACGCCGGCCAAGTTCGACAACGCCTACTACATCGACTTGCTTGCGAGGCGCGGGCTCCTCACATCCGACCAGGAGCTCTAC
ACCCAGGGGTGCGAGACCGGCGACCTGGTGAAGACGTACGCCATGAACGGCGACGTGTTCTTCGCCGACTTCGTGAGGGCCATGGTTAAGATGGGGAACATACGCCCAAAGCATTGGTGG
ACTCCGGCGGAG
GTCAGGCTCAAGTGCTCGGTGGCCAACACCCATTATTGATGCCCATACTATTAAGTACAACACAACTATTTTGGAATCATTTGTAAGTGTGAAATTCCTTTCGATTTA
ATTGTACAACAAACTGTAAGCTGTATTATTCTTTTGTACTTCATCTGTTTATTCATTTTTTTATGATGTATGGGAGATCACTTTGCCCTGGAAGTTCAATCACTCGCATACATGCACAAT
GCCCGCTCTAGGTCGCCCGCTCTGATACTATGTCGGATATTATAGGGAAGACATGAATACTGTAAATATTTGACAAATATACATGAGTACATAGAGATCGAGGAGATAAGGAATGATTAC
AGATATGGAAGTAATCCACACAAATCAATCATATCCTAATATAACTCTAACTACCATATACTCTAACACTGACCACCACAACACCCGCCACCTGCCGTCGCCTACTCGCCAAAATCCATC
AGCTCTTTCTTCATTGCCATCACTTACTTCATTGCAACTGATTTTATTTTTATTTGCTCACGATTTAAAAGGTATGATAGGATTTGGAATCTATGGTTCATAGAGGTAGAAGGAGGGGAT
CGTTCTGGCTTGTGGTTAGGTCGGGACCTAGGGCCGGGAGGACATAAACTTAACCAAGGGCAAAACAGTCTTATCAAGTTGCTTTGTATTTCCATTAAATTAATTATTTTTGTCCTATTA
ATTGCATCAGTTTGGACGGCAGTGGCAAACAGAAGCACAGAAAATCAACTTCAGTTTTAAATTTGCAGTTTGTGTTTTTATAATGGCTATTTCGAATTAGGGGTTGAAAGTAGTGGCATA
TTTGCAATTCTCCCTAAAATATAATATCTGGTCAGCCAAGGAGAGAAAGCTATGCAAAATGTCTATATTGCCCTCCTCTTCTAAAGCCTCTATAAGTGATGAATATGTTGGTGCATCTGT
AGGTGAGGTACAGCAGGCTTGAAACCATCTATAGGTGCACCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGTTGTGATGCCTCCATCCTTCTGAACGCTACGGACTCCATGGAGAGCGAGAAGGATGCCGAGCCCAACGCCACCCTCGCCGGCTTCGACGTGATCGACGGCATCAAGTCCGAGCTCGAG
CGCAGCTGCCCGGCCACCGTCTCCTGCGCCGATGTTCTCGCGCTCGCCGCCCGCGACGCCGTCGCGATGCTCAGCGGGCCCAGCTGGGGCGTGCTCCTCGGCCGCAAGGACTCCCTCACC
GCCAGCATAGACATGGCCAACAAGGATCTCCCGAACCCGAAAGACAGCCTGGCCGAACTCATCAGGATGTTCGAGAAGAACGGCCTCGACGAACGCGACCTCACCGCGCTCTCCGGTGCG
CACACCGTCGGCATGGCACATGACTGCAAGAACTACGACGACCGCATCTACAGCCGCGTCGGCCAGGGCGGCGACAGCATCGACCCATCCTTCGCGGCGCAACGCCGGCAGGAATGCGAG
CAGAAGCACGGCAACGCCACTGCGCCGTTCGACGAGCGGACGCCGGCCAAGTTCGACAACGCCTACTACATCGACTTGCTTGCGAGGCGCGGGCTCCTCACATCCGACCAGGAGCTCTAC
ACCCAGGGGTGCGAGACCGGCGACCTGGTGAAGACGTACGCCATGAACGGCGACGTGTTCTTCGCCGACTTCGTGAGGGCCATGGTTAAGATGGGGAACATACGCCCAAAGCATTGGTGG
ACTCCGGCGGAG
GTGAGGTACAGCAGGCTTGAAACCATCTATAGGTGCACCTAG

Retrieve as FASTA