Entry information : PEchKat02 (PechrKatC)
Entry ID 7289
Creation 2010-04-09 (Marcel Zamocky)
Last sequence changes 2012-04-26 (Catherine Mathe (Scipio))
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: PEchKat02 (PechrKatC)
Name (synonym) PEchKat02 (PechrKatC)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Penicillium
Organism Penicillium chrysogenum    [TaxId: 5076 ]
Cellular localisation Peroxisomal
Tissue type N/D
Inducer Oleate
Repressor N/D
Best BLASTp hits
Perox score E-value PEchKat02
start..stop
S start..stop
AnKat03 931 0 1..501 1..501
AorKat03 926 0 1..501 1..501
AniKat02 916 0 1..496 1..497
CimKat02 902 0 1..494 1..496
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4285069..4285090 22 N° 2 4284960..4285012 53 N° 3 4284727..4284906 180 N° 4 4283415..4284665 1251
complement(join(4283415..4284665,4284727..4284906,4284960..4285012,4285069..4285 090))


exon

Literature and cross-references PEchKat02 (PechrKatC)
Literature REFERENCE 1 Kiel J.A.K.W, van den Berg M.A., Fusetti F., Poolman B., Bovenberg R.A.L., Veenhuis M., van der Klei I.J. (2009) Matching the proteome to the genome: the microbody of penicillin-producing Penicillium chrysogenum cells. Funct Integr Genomics 9:167-184.
REFERENCE 2 van den Berg M.A., Albang R., Albermann K., Badger J.H., Daran J.-M., Driessen A.J.M., Garcia-Estrada C., Fedorova N.D., Harris D.M., Heijne W.H.M., Joardar V.S., Kiel J.A.K.W., Kovalchuk A., Martin J.F., Nierman W.C., Nijland J.G., Pronk J.T., Roubos J.A. , van der Klei I.J., van Peij N.N.M.E., Veenhuis M., von Doehren H., Wagner C., Wortman J.R., Bovenberg R.A.L. (2008) Genome sequencing and analysis of the filamentous fungus Penicillium chrysogenum. Nat. Biotechnol. 26:1161-1168.
Protein ref. UniProtKB:   B6HSG0
DNA ref. JGI genome:   scaffold_2 (4285090..4283415)
Protein sequence: PEchKat02 (PechrKatC)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   501
PWM (Da):   %s   56935.83  
PI (pH):   %s   7.08
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGQDNEPKTYRYNETPVYTASNGCVMDPQAAQRIGPNGPLLMQDFHLIDLLAHFDRERIPERVVHAKGAGAYGEFEVTDDISDITIIDMLKGVGKKTKMLTRFSTVGGEKGSPDSARDPRGFAMKFYTEEGNWDWVFNNTPVFFLRDPAKFPVFIHTQKRNPQTNLKDATMFWDYLSTHHEAVHQVMHLFSDRGTPYSYRHMNGYSGHTYKWIKPDGTFNYVQIHCKTDQGNKTFTNDEAAKLSAENPDWHTQDLFEAIQRGENPSWTCYVQVLSPEQAEKFRWNVFDLTKVWPQKEVPLRRFGRFTLNKNPQNYFAEIEQAAFSPSHMVPGVEPSADPVLQSRLFSYPDTHRHRLGGNYEQIPVNCPLKAFNPTHRDGYMNVNGNYGANPNYPSTFRPLAHKAVKASQEHEKWSGAVIAEQYPVTSEDYVQANGLWQVLSRTPGQQENFVGNISGHLCGADERVRRATYEMFRRVNADLGSRIQSATEAHVTGAPPARL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST available. Strain="ATCC 28089 / DSM 1075 / Wisconsin 54-1255".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTCAAGATAACGAGCCTAGTAGGTTTTGCACCCATCAAATCCTAGAACACCAACTAATGGTCTTCTCTTCGCAGAAACCTACCGCTACAATGAGACTCCGGTCTACACGGCCTCCA
ACGGCTGCCCA
GTACGCCTAGCTCACTTCCTCCTGAGTCGCAAGGTCTAATCATATACATATAGGTCATGGACCCCCAGGCTGCCCAGCGCATTGGCCCTAACGGCCCTCTTCTGATGCA
GGATTTCCACCTGATCGATTTGCTGGCACACTTTGACCGTGAGCGCATTCCTGAACGCGTGGTTCATGCTAAGGGTGCTGGTGCCTATGGCGAGTTTGAGGTCACTGATGATATTAGCGA
TATC
GTATGTACCGTCTGGGCAACTTCTATAATTCCGCGGAGAACACTAGGCTAATACCGCATAGACAATCATTGATATGCTCAAGGGTGTGGGCAAGAAGACGAAGATGCTCACCCGCT
TCTCGACCGTCGGTGGTGAGAAGGGATCCCCTGACAGTGCCCGTGATCCTCGCGGATTCGCCATGAAATTCTATACCGAGGAGGGCAACTGGGATTGGGTGTTCAACAACACCCCGGTTT
TCTTCCTGCGCGACCCTGCTAAGTTCCCCGTCTTCATCCACACCCAGAAGCGCAACCCGCAGACCAACCTTAAGGATGCCACCATGTTTTGGGATTACCTTTCCACCCACCACGAGGCCG
TTCACCAGGTGATGCACCTGTTCAGTGACCGCGGTACCCCGTACTCCTACCGTCACATGAACGGCTACTCCGGCCACACCTACAAGTGGATCAAGCCAGATGGCACGTTCAACTACGTCC
AAATCCACTGTAAGACCGATCAGGGCAACAAGACCTTCACCAACGACGAGGCAGCGAAGCTGTCCGCTGAGAACCCGGACTGGCACACCCAGGACCTATTCGAGGCCATCCAGCGCGGCG
AGAACCCCTCCTGGACCTGCTACGTGCAAGTTCTGAGCCCCGAACAGGCCGAGAAATTCCGTTGGAACGTCTTCGACCTCACCAAAGTCTGGCCGCAGAAAGAGGTGCCTCTGCGCCGAT
TTGGCCGCTTCACACTGAACAAGAATCCGCAGAACTACTTCGCGGAGATCGAACAGGCCGCTTTCTCCCCCTCTCACATGGTTCCCGGTGTCGAGCCCTCCGCCGACCCAGTCCTTCAGT
CCCGTCTCTTCTCCTACCCTGATACGCACCGCCACCGCCTGGGCGGCAACTACGAGCAGATCCCCGTCAACTGCCCGCTCAAAGCCTTCAACCCCACACACCGCGATGGCTACATGAACG
TCAACGGCAACTACGGCGCTAACCCTAACTACCCTTCTACCTTCCGTCCGCTCGCCCACAAGGCCGTCAAGGCTAGCCAGGAACACGAGAAGTGGTCCGGCGCTGTCATCGCCGAGCAGT
ACCCTGTGACCTCAGAGGACTACGTCCAGGCTAACGGCCTGTGGCAGGTCCTTAGCCGTACCCCCGGCCAACAGGAGAACTTTGTCGGTAACATCTCTGGTCACCTGTGCGGTGCCGATG
AGCGTGTCCGCAGGGCTACTTATGAGATGTTCCGTCGTGTTAACGCGGATCTTGGTTCTCGCATCCAGTCTGCTACGGAGGCTCATGTTACTGGTGCCCCGCCAGCGCGTTTGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTCAAGATAACGAGCCTAAAACCTACCGCTACAATGAGACTCCGGTCTACACGGCCTCCAACGGCTGCCCAGTCATGGACCCCCAGGCTGCCCAGCGCATTGGCCCTAACGGCCCT
CTTCTGATGCAGGATTTCCACCTGATCGATTTGCTGGCACACTTTGACCGTGAGCGCATTCCTGAACGCGTGGTTCATGCTAAGGGTGCTGGTGCCTATGGCGAGTTTGAGGTCACTGAT
GATATTAGCGATATC
ACAATCATTGATATGCTCAAGGGTGTGGGCAAGAAGACGAAGATGCTCACCCGCTTCTCGACCGTCGGTGGTGAGAAGGGATCCCCTGACAGTGCCCGTGATCCT
CGCGGATTCGCCATGAAATTCTATACCGAGGAGGGCAACTGGGATTGGGTGTTCAACAACACCCCGGTTTTCTTCCTGCGCGACCCTGCTAAGTTCCCCGTCTTCATCCACACCCAGAAG
CGCAACCCGCAGACCAACCTTAAGGATGCCACCATGTTTTGGGATTACCTTTCCACCCACCACGAGGCCGTTCACCAGGTGATGCACCTGTTCAGTGACCGCGGTACCCCGTACTCCTAC
CGTCACATGAACGGCTACTCCGGCCACACCTACAAGTGGATCAAGCCAGATGGCACGTTCAACTACGTCCAAATCCACTGTAAGACCGATCAGGGCAACAAGACCTTCACCAACGACGAG
GCAGCGAAGCTGTCCGCTGAGAACCCGGACTGGCACACCCAGGACCTATTCGAGGCCATCCAGCGCGGCGAGAACCCCTCCTGGACCTGCTACGTGCAAGTTCTGAGCCCCGAACAGGCC
GAGAAATTCCGTTGGAACGTCTTCGACCTCACCAAAGTCTGGCCGCAGAAAGAGGTGCCTCTGCGCCGATTTGGCCGCTTCACACTGAACAAGAATCCGCAGAACTACTTCGCGGAGATC
GAACAGGCCGCTTTCTCCCCCTCTCACATGGTTCCCGGTGTCGAGCCCTCCGCCGACCCAGTCCTTCAGTCCCGTCTCTTCTCCTACCCTGATACGCACCGCCACCGCCTGGGCGGCAAC
TACGAGCAGATCCCCGTCAACTGCCCGCTCAAAGCCTTCAACCCCACACACCGCGATGGCTACATGAACGTCAACGGCAACTACGGCGCTAACCCTAACTACCCTTCTACCTTCCGTCCG
CTCGCCCACAAGGCCGTCAAGGCTAGCCAGGAACACGAGAAGTGGTCCGGCGCTGTCATCGCCGAGCAGTACCCTGTGACCTCAGAGGACTACGTCCAGGCTAACGGCCTGTGGCAGGTC
CTTAGCCGTACCCCCGGCCAACAGGAGAACTTTGTCGGTAACATCTCTGGTCACCTGTGCGGTGCCGATGAGCGTGTCCGCAGGGCTACTTATGAGATGTTCCGTCGTGTTAACGCGGAT
CTTGGTTCTCGCATCCAGTCTGCTACGGAGGCTCATGTTACTGGTGCCCCGCCAGCGCGTTTGTAG

Retrieve as FASTA