Entry information : TadKat01
Entry ID 7293
Creation 2010-04-11 (Marcel Zamocky)
Last sequence changes 2010-04-11 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-06-22 (Christophe Dunand)
Peroxidase information: TadKat01
Name TadKat01
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Metazoa Placozoa Trichoplax
Organism Trichoplax adhaerens    [TaxId: 10228 ]
Cellular localisation Peroxisomal
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TadKat01
start..stop
S start..stop
PvanKat01 777 0 6..498 3..495
DmaKat01 763 0 6..498 4..498
AviKat01 762 0 5..502 3..499
XtKat02 741 0 4..504 3..506
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 13457..13516 60 N° 2 11671..11842 172 N° 3 11229..11339 111 N° 4 10954..11084 131
N° 5 10765..10815 51 N° 6 10479..10658 180 N° 7 10295..10405 111 N° 8 10126..10206 81
N° 9 9898..10050 153 N° 10 9684..9822 139 N° 11 9524..9603 80 N° 12 9219..9446 228
N° 13 1..24 24  
complement(join(1..24,9219..9446,9524..9603,9684..9822,9898..10050,10126..10206, 10295..10405,10479..10658,10765..10815,10954..11084,11229..11339,11671..11842,13 457..13516))


exon

Literature and cross-references TadKat01
Literature Srivastava M., Begovic E., Chapman J., Putnam N.H., Hellsten U., Kawashima T., Kuo A., Mitros T., Salamov A., Carpenter M.L., Signorovitch A.Y., Moreno M.A., Kamm K., Grimwood J., Schmutz J., Shapiro H., Grigoriev I.V., Buss L.W. , Schierwater B., Dellaporta S.L., Rokhsar D.S.(2008) The Trichoplax genome and the nature of placozoans. Nature 454:955-960.
Protein ref. UniProtKB:   B3SC13
DNA ref. GenBank:   DS985267.1 (415861..402346)
EST ref. GenBank:   GR417349.1 [Fragment]
Protein sequence: TadKat01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   506
PWM (Da):   %s   57451.55  
PI (pH):   %s   7.52
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSKNSRDKAADQLKEFRENNDPTTLTTSHGAPAESITDSVTVGPRGPILLQDITLIDHMAHFDRERIPERVVHAKGAGAFGYFEVTHDITKYCKAKVFENVGKRTPMAVRFSTVGGESGSADTARDPRGFALKFYTEEGNWDLVGNNTPIFFIRDPIFPSFIHTQKRNPVTHLKDPDMFWDFISLRRETTHQVSFLFTDRGTPDGYRHMNGYGSHTFKLVNADNEAVYCKFHLKTDQGIRNLTGEKAQEISGLDPDYAMRDLYNAIASGNSPSWTMYLQIMTFEQAEKWRFNPFDVTKIWPHSEFPLIPVGKMVLNRNPKNYFAEVEQIAFAPANFVPGIEPSPDKMLQGRLFSYNDTHRHRLGTNYAQLPVNCPYATKVGNYQRDGPQTFNDNHSGVPNYYPNSFNGPIANVNRATPHTVVIGDVKRYNTADDDNFTQVTVFWRKVLNEQERTALVNNIVGHLCMAQSFLQERAIENFSKVDPEYGRRIREGLNRKEEGAKLM*

Retrieve as FASTA  
Remarks Complete sequence from genomic (12 introns) and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAAAAAATTCCAGAGATAAGGCTGCCGATCAACTCAAAGAATTTCGTGAAAACAACGTATGTTATTTTATACGTGTACAGTAATTAGATGATCTTATATCTCTTTGCATGAACATT
AGATTAATCGCGCTGCCGTTGTACAGTACTGTGAGATGTACTGTACAGTACTGTACTGTACTGTATATTGATTAATTAATTACAGTAATTGATGGCGAGTATAATGCAACTCGACGTTTT
GATAATCAGGACTTCTAAAATTTAAGAAAGAAGCCCCTGGTTGGTATTCTCCATAGTATGCAAATACAATTCTTCTTCATCCACTAATCCCAATACCAGCCGAACAATCGATCGACTGGT
TTTTTAGTTTTTTGATTTTTATTAACAATTTCGGTACAGATCTGATTTCGGATTTTGCGTTGTATTCCATATGAATACTGCTTTCTACAATACAGTATGTTTACAGTATACAGTACTGAT
ACTTAAAAATTAAGTTAAACGAGAATTAACTGCATATAAATACGATAGATGCCATCACGTAATTACAGAGGACAGTCCCGCATTCATCATTAAGCTATGCTAATTTCATCAGGCGTAACG
CGATGGTAGAACCACTTACCCGTATCTTTGTATCTATGTGACAACCAGTGTTGTTTGGGGATCTTAGATCTCCGCGGAGCCCTAGAACCACTGGTAACAACGTAACAACACATGAAGAGT
AAAATATGTTGATAGTGCGTAAATATGTAATCAAAACACAGTGGATATGTAGATACACTATGCTAATAAAATTACTGTATAGTTGCATACGGAGATTGCAATAAAGACTATCCTCTGAAT
CTCCTCTGCATCGTGTTCGATAGCTAGTCATTAAATACATTTAACCAACCTGCTACGCGACCACCTACTATTACTGTACGGTATTGCGATCTCAACCATAAATACACACACGCATATACT
GTACATACAGTACAGTGTCCACACTGGTACATGCAGTACAATTATGTACCTAGTTTTAAGAGCTAGCTTGCTTTACGGAAGTAAGCGCTTCAAGACTATTTCGTTGATCCAGTTAAAATT
TCGTTATTTTGCTCATGTATTATGCAACTGTACCAGCATGTACCACTAAGAGTTCGCTAGATACCTTACGAAAATACTTTGGGTCTACGCACAACATACGAATTTCGTTATAATATGAAC
TTTCTTTTAAACTAATAACCAGCTGTACTGGAACATAGCATTGTATGTACGGAACTGTGCTGGCTTTTGCTACTGTAGTTTATTGCTAAGTACCGTATGTCGTAATACGATTGCTGTGTG
TAGTGTTGTCAACAGCTCATATTGAGAATATAATTCAGAATTGTAGATGAATTTGTTCCATATGGCGAAGAAAATTGATCTCCAGCTCATTAACGTACACTGTAATGTGAAATTAGCAAA
TACTGTATGCTGTTAGCTGCAATTACGCAATTACGTTTTACAGATAACTATACCAGTATGTACTGTACATTTTAACGCGTTCGTTTCTCTGATCTGCAAGTAAAATTTATAAATTGGATT
ATTCGCGTTATTCTAAGTCGTCTCTAACCTTTTAGCAATGTTAGCTAAATAAGCATAACGTAATATATTAAAATATTGCAATTCACTTATACGCATATACGTATGTATCTATAGGATCCT
ACTACTTTGACGACTAGTCATGGTGCTCCTGCTGAAAGTATCACTGATTCCGTTACAGTGGGACCTCGTGGACCTATTCTACTTCAGGATATTACTTTAATTGATCATATGGCTCATTTC
GATCGTGAGCGTATCCCAGAGAGAGTTGTTCACGCTAAAGGAGCAG
GTGATTGCAGAGCCATCCGTAATTTGTATTACAGTAATAGTACACATTCACGTTAATCTATGTTACTTTGTATG
GATAAATACGAGTACAGTGCTAATATACAGTATTGAGAATATGGTTACGTATTACCTACTATAAAATGTTTATTTATCAGTTACGCGATCGCAAATGCGTTTCAATAACTACCATACATA
CATTGATGTAGAGTAATACGTAAATACATAAATAAAACAATAATTAACTAGAGTCAATCGCACTTTGCAGATATAAAATGATATAAATCGCCAATGACAATCGTGTTCGTAATATTTATT
TTCTTTATTGCCTGTAGGTGCATTCGGCTACTTTGAGGTTACGCACGATATTACAAAATATTGTAAGGCGAAAGTATTTGAAAATGTCGGCAAACGTACACCTATGGCTGTACGTTTTTC
CACCGTAG
GTACGCCGTACATACTGTCTCTGCTACGTTTTAAGCTCAAAGTAAATGTCTCGTATTGATCGCGGTACAGTAATGGTATACGGATTTTTTTATGTCTACTTCCACGATAATT
ATACGGTAACTGTACTAACTGTTCATTACTAGGCGGCGAATCAGGAAGTGCGGATACTGCTAGAGATCCTCGTGGGTTTGCCCTTAAATTCTATACGGAAGAGGGCAACTGGGATTTAGT
TGGTAATAACACTCCAATTTTCTTTATAAGAGATCCCATCTTG
GTATGGCTAATATAGGAATAAAGTGTATTAAATTATGACGTAGCATACTGTACCTTGTGTTATTTCGGTGAAGTCAA
AAAGTAGATTGACGATACATACGTTTGGCTTGGTTTGCTTATTATCAAGTCTCTTTTTTAGTTTCCTAGTTTTATTCACACCCAAAAAAGAAATCCTGTAACCCATCTGAAGGTAGGTTG
GTTTTATCTAATTGCCTTCATAAGTAATGGATATTATTTATTTAAGGTGAACAACACCAAGCATACTTATAATTTAATTATCTTTGTAATTTATTTAGGATCCTGACATGTTTTGGGATT
TTATTAGCCTCCGACGAGAAACAACTCACCAGGTTTCCTTCTTGTTTACGGATCGCGGCACTCCGGATGGATACAGACACATGAATGGATACGGGAGTCATACATTCAAGCTAGTAAATG
CAGACAACGAAGCTGTTTACTGCAAGTTTCATCTGAAG
GTCTAGAAAATTCTATCAAATTTCATTCATTCTTCATAAAATATTGTAAAATTTCTAATCTATCATCTTTTAGACTGATCAA
GGCATTAGGAATTTAACAGGAGAAAAAGCTCAAGAAATTAGTGGATTAGATCCCGATTATGCAATGAGAGATTTATATAACGCAATTGCCAGTGGAAACTCT
GTACTAATAATTATTTTA
TAGTTTAAATGTTTTACTGTAAAACTAATCAATCATTGATTACCTAACGTTTCTATCTTTAAACTTTCAGCCGTCTTGGACCATGTATCTTCAAATAATGACTTTTGAGCAGGCTGAGAA
GTGGCGCTTTAATCCCTTTGATGTGACGAAA
GTTAGCTTATAGCATCAATTACATATTTTTTCTTAAGAAAATCGAAAAGTAATTTCAAATTTGCGTCAATATAAGATTTGGCCTCATAG
TGAATTTCCCTTGATTCCTGTTGGAAAAATGGTCTTGAACCGCAATCCGAAAAATTATTTTGCCGAAGTGGAACAAATAGCTTTTGCTCCGGCTAATTTTGTTCCTGGAATAGAACCATC
GCCTGATAAAATGCTGCAG
GTAATTTGTATGTAAATTAAACGTTTATAACGTAATCTGCTGATTGGACTCAATTTTTCTACATGATGTATACAGGGACGTTTGTTTTCTTATAATGATAC
TCATCGACATCGCCTTGGAACTAACTATGCTCAGTTACCTGTTAATTGTCCCTATGCAACGAAAGTTGGTAATTATCAAAGAGATGGTCCACAAACCTTCAATGACAACCACA
GTAAGTT
ATGCTATTTTTGGTAAAAGACATAAACTCTTAGTAGATTTCAAATTAACATATTCGACATATTCTCTTCAAAGGTGGCGTTCCAAACTATTATCCTAATAGTTTTAATGGTCCTATTGCA
AATGTTAATAGAGCTACTCCACATACGGTCCAA
GTATGTAGATTTTATGAAATTAATTTTCGAAAACTTCGATCATGAGTAACGTATTTGATATTTGTTTCGGTATGTAGGTTATCGGTG
ATGTGAAACGCTATAATACAGCAGATGATGATAATTTTACACAAGTGACAGTATTTTGGCGAAAAGTTCTTAATGAGCAGGAGAGAACAGCATTGGTTAATAATATTGTGGGACATTTAT
GTATGGCACAATCGTTTTTACAGGAGCGGGCTATCGAAAACTTCTCGAAAGTTGACCCTGAGTACGGTAGAAGAATCAGAGAAGGATTAAATAGAAAA
GTGAGTTCAATGTATTGATCTT
TTTATTGTCTTAACCGTAAGTTGTAATATTAGGTATGACGTCATTGAGGGTATTAGGGCTTTAATTGTAATCATGATATTTTTTAGGCGCAGGCAGGCTTGTAATGACGCAGGCCTTGGT
CTTTGGGAAATGTAATTGGCATTCATCACTGAGTTTAAAATTTATGCAGCATAATAATCTACGTTTATGCGTACGGGAAAAATTTGATTTGATTTGATTTACTTTTTCGCATGCTTGCTA
TAATTGCATGGTATATTGTATGAATTTAATCATAGATTCATTCTGTTGACGGATAAATTGCGATACTTTGATATTAGTTACTGGAAATATCCATAAATGAAAACTTATTTTAGTTAATCA
TACGCCGATAGAATTCGTTAGTTGATGATCCTTCAATGAATGTTACTTTAATGATAAATGATCCGCATGTCTGTCGGTAATGCTGCTAGTTCTTTAATTGTAATTTCAGCCTTGATTTTA
TCTTCGTAATGAAGCATGGACTACCTGCGTAAAGTAATTATAGCATTATAATTTGTGATGGGTCTAACAATGTGGTAGATTTTATAAATTATCTGCGATTGGAGAATCTTGATAACCTAA
CATATATGGAATAAATTGTTAGTATCGGTAGTCCAATCATACGCTGTGAACGTACTTGAACTGAGCACAGTATAACTAGGTGAGATAAATAAATTCTATTTATTGAGTGAGAGAGTACAG
TAATTCAATATTATTATCACACTGTACCAGTATACTTATACGCATACGGAAGACCGTTTTATGCTAACGGGCATTAAGGTGTATAAGCGCTTTAGTTTTAAAGTTTATGTTAACTCATTT
TTTATTTCTATTAGGACTTTAACTTACGTATGTTAGCTTACAATTTCATAGAAGTTCTTCGGAGTAGATAGGTATGTCAATCTAGGGTTTAGTGGGTAGTTTCATTAGTACGCGCAGTTA
TATCGATGTTCATACTGTACTCATTATTGAGTAGCCACCGCAAGTGAATTACTGTAATTTTAGAAATTATAGAAACCGCCAAGTGTACTTTACGTGTGTGTCCGATAGTGTTTTTGCTAT
GTTATTGATGCATTATATAAGTACTAGTAATGTACTAAAACTAGTCAACAGATAACAAATTTAACTAATTTTTCAATTTCGTATATTATAGTACAGTATACAGTAATTAATAAGTGAATT
TCTATTATTACTTAAAGTGGAAATTTTGAACAGACCGATACAAAAAAGGAGTTTTAAGTGAAATATACGGCTAGTGTGTCACTGTTACGTAACAGCGCAATCCCTGAGACAATTAATTTG
ATGTTAGTATAGTATAATTAACTATTATCGTGCCCTTTCTGCATTGAGTATGGATGGACCTGATAAAGGTAGGGACTCCTAAAAGGGTATAACTATGTTATTAACGTTTCTATAAATATA
GCTTACTGTACTAAACATATAAACATCTTTATACGGTATATATTGTATACAGTATTTTGCAAAGCTATTTGTCCGTCTGCCTGACAGTTACGCTTTGTCATTCCGCTCTACTGTACTATA
CAGTAGGGTGTGTTGGTGAAATACAAAACTTCACGCCGAGCGACTAATTATCTACCTCAGCTCTTCAAACTACCGACAATGATTGTTTTTTGGATGTTACTTTGTTTAAAATCTAGCGAA
GATTCTTTTAAGAAGGTGAGGTGGAGGAAATTCGGATGCTTCCATCTCATTTTTAATATTACAGTAGTTCATAGCGATGATATCATACGGTATACGATAGAGTCCAGGTACAGTTGTACG
GACGGCGCACCGAAGTCGATCTGTTGTGTCACTCAACCGTACTCGGTGTACTGTACCGTGTGAATCTAAAACTATGGTTTATAGTACTGTAGCCTATATTCTGTATAGTACTGTACACTT
CAAAGCGGCCTTCGCGTGCTGTACTGTACATTTAGTGTACAACTGTACCTGGACTTACTGTATCGTATCCTGTATGATACCATTGCTATCTACTATGAAGAATTTGACTAAAGCATTCGA
ATTTCCTCCACTTCCCCCTCTTAAACTAGTCTTCGTTAGATTTTAGCTGAAGTAATTTCGAAAAAATTTTATAGTCAATAGTTTGAAGAGTTTAGCTAAATTATTATTCGTTCGGCGTAA
GGTTTCGTTTTTCAGCAATACATCGTACTGTACAGTGTACAGTTCTGTACTGCGCTTATCGATATACTGTACTGTAATGTAAACTACAGTACAGTACAGTAATCGTAGCATCGGCAAGCT
ATTATAATCAATTAATTACTAGTAGACCCTTCGTTCGTTATACTTCGCGTACAATAGTGAATATACAGTATATCTACAATTTTCCTGGCTGAACATATTACTGTACTGTACAATACTGTA
TATACTGTACACTTTGGAACGAATACGAATCATAACGAGCTACTCTACCTCAAGCTCCTTACTATAGCATTTATTTGTTTATTTTATTTTATTCATCGTAGATGATGTGAATGTGGTATG
AACGTATGAACTTCTTTTTGTAAATAGACAATTCGTATGCGCTTTCAGTAGATATGCTCATTTATTTCATTTTTTTTATTGCATCTCTTCCGTTATCCATGTTCTTTTGGTTCATCTCAT
CAATTATTACGGAACAGAATTTGTCTATAAATTATGATTTGCTGTGGTCGAGAACTACCCCTATTAGTTGGTTCATATGTACTTATGTTCCCGTAATCGTAGCTACAAAATGCTATGAAT
TAAGGCTTTTGAATTTCTCAGGGGCTATATCAAGCTCTATACTTGGATTTGTGCTCATTTTGACTAGTAGCTGCTTCTTCTTCAGCTTTGCTGCGTATTTATTCATTGCAATAAAATCAA
TCAGTTTTAGAGTGAAAAGTAAAAACGGGTACACTGATATTAGTGGTAAGTGCAATCAAAAATTCTAGTTTCGTATAATATGCAATACTGCCATAGAAAGCCTATATACTGTATGCTGAC
ATGTACGATCATATTCAATTTCTAGTGGAAATTAGAATGTTGACTTGTTTCTCCAGCTAACCGTAAATTATCTTAACGTCTTTCAGGATTCCTCTAAATTATGATATTATGATAATATAT
TTAATGCTATCCATAGTACGCGTATATGAAATTACTTTGATATTGTCTCAGTTTATCTAATTAATCAAAGATGTGACGCTCCATAGCATACCAGCCTCAGTCATTTTGCGCAGAATTTCT
ATGTAAAATGTCTCCAGTTACAGTACTGTATGTTTAACTTCTCATAGTAAATTTTTCGTACAGTAATTACGGGGGTGGGCTGTCTTTAATTTAGTGTACAATCGGTGTTGCGTTATGATC
ATGCTTCCTATCTTTACAGCATCGTATTGTTTACCATACTTTATTTCTAGTAGTCTATTCTAGCCTATTATTCGAAGATACGAATGTTTGAATACTAGCTTTAAATACTCTGGCTGTCAA
TAACAGGCACTGCAAGTGTATCTTAATTCGTAAAACCGTTTTTAATTTTTTACGGATTTGGTGTTAAATACGTAATGTGCTTTTATCAGTCATTGATGAATACTAAATGGAGATCGTATC
TACATAAGTATGTTTAAGATAGGCAATATATTTTACTAAGTGTTAGCTAAGGTAGCAGGTTGTACTGTTTGAATACAGGCACCGTATGAAGAAATATACAGGATATTCATTGCAGATGTT
TTTTATTCTTATGTACTGGATGCACACTCAATTCTCTAGCTGGCGAGAAGAACTGGTATCAAATGATTTTTATCGGAGGACTATCAGCTTTGCTGTCATACTTTTACGCCGTCACTGTTG
GTTTAGGTGAATTACCAATTAATTTCTCGAAACATTATAACGCCTCTATCCTCGGGATAGCTGTCATGACATCATGGGCTTGCTGGACTGGCGATACTTTGGCGACAGAGGTCAGACTAA
CCTCGGGAAGAATATCGCCTCATTTGATTTCTACCTTCGGAATGCTTCCTTTACGAGCCAATGAAGCTATTGCAATTTTGGGTACTTTAACAGGTGCTGTTGGAGGTTTATTGATAGGAA
TTACATATTACCTTTCCTTATGCTTGTGTACCTCTTCGTCAATCTGGTCGAATTATCCTCCACAGTGGCCATTAATGCTATGTTCGGCCTGCGCTGGATTTTTAGAATCGATAATTCGTT
CTTACTTAACAACTAGCACGCGATTTTTCGTTCAGTGTCAGCTTACTGAAAATATCCTATTCTATCGAATTCAGAATGTTCGTGATGTTGCAAGCGCAAATATCTCAAAGACTGGATGTT
TAGGTTTACTCTCAACATTTATTACTTCATGCATAATCTGTTATACATCAATTAAAATATGGCCAACTAACTAATTCTGCGATGTTACTGCTTATGTATTAATCAATCATTTACTGTTCC
ATGATATCTCATAACAGAATTTTAGGTCTATCAGCAGCATGCATATATGCGTTTTCACGTATTCACAATTTTGCATTCATTATTTATTATTATTTATCGAAAATATAAGTATTTAACAAT
TAGTAACGGGTTACACAGGTTAATTATTGTATTGATTCATAAATACCGATAAGCACAGTAAATGTTAAAGTTTTTAAACTTTTCATTTACTCAATTTATAAGGCTAACTCTATTGCAATA
ACTTTTACCGATACTCTGAGCTCTAGTGATAATACATATCAGCTTTGATTAGTTAATATGCTGTAGACTCAAATATTTTTTGTACCTTGTTATTGACTGTATTCATAGTGTGTTTACATG
TACAGATATTTACGATTCTACTCTGTTACGAATTATCAATTTACAAAATACCTTTAACATGAACTACTAGATACTCCTAGCAGTCATGCCTTTACGAATCAGTAAATTAAATTATGATTT
GTCATGTGTACGTGCATTAAGATCTGATTAATGAAGACATTTATAACTTGTGCATGTAGATAAAGGATACAAAGTAATGTAAGCAGACCTTTAATTAATGACATCCATATAAAAAATGTT
GATTCTATTTACAATTATTTCGATAGAAATAAGAACTTTTCACATGTTCTGATATAACATTATACACATATACTGTCCGTACTGACCAGTGTTTAAAACTGTGTACTCATTTTTTATAAA
CAAAGAATAAAGTGCCAATATCTACTTTGGATGTATAAGTATTGTGCTGTTATTCTCTAAAATAGCCTGAAAGCCATAGGACACCAAATACAGATGCAGCCGCTGCTGTAGCCACACCAA
TAATTGCCGGCCACCCAGGCGAAGCAAGTCCTTCGTATCGAGCTGCACGCTTGTGATAAAGCAAGTTAATTCAAAAGTTACAATAGTTTACAATGCAATGATCGTAACTATACTAATAAT
TGAGCAATGCTGTACAAGTACTGTACAGTGTAGTGCATTTAACAGGTACTTCTAAGAACAGACATACATCTTTTTATTAGTCCCCGCATTTAATGTTCAGTCAACTGTAAGTACAGTACC
TCGAAGTGCACTTTATACAAAGTACCATGGAAAAACTCACTAATTCAATATAGTGCGATAGTTCGCATATAAAAATGATATTACTTACCCAGCCTCCTTGCCTTGCTATCCAATTGGCAA
TGTGCTCGCCGGAGATAAATCTTACGATAAAATTACATATTCGACTTAAGAAGCCCTGAACTCCACTTCGCATAACATCTATAGCTATCTGATATCCGAAAGCCATAAGAGTGACAATTC
GTCGCCAAGAAATACCATCACGAAATAAACGTCTAGCAACACCAGCAAAGGTTCTGTAGGCTGTTCCTGGGTTTATATCTAAATGCGTTATCATCAATCGAAATTCATTTTGGAAACGGA
CACTATATGAGTCACCCAGCTGCGCTAAATGGCGTCCTATTTCAGATGTAGGAGATGATGGTGTGATCGTTTGATTGCTAGATGACTGTACTTGATCCGCAAAAGAACGAACTTCTTCTG
CAATAATCCCACCATCCCGTTCGGCCTGGTAGCTTTCGACAACAAAACTACGAAATATGCTACTTGTTTCATTAATTACCTCTTGTTCTGAAACTGGTAAATGAGCCGGATTTGCCGATA
GTTGGCGCCTTATAACTTGAGCTCGTGTTACCCGAAACTGACTGCGTGAAGTATTTGCTTCTTCCTGTTCGTCGTTATTCTCTCCATTTTCTAGCGATTCAGCTATTGTAATAGTGCTAG
ACATTTCCCGACTACCGTAAAAGTATTTAATCGTGATCTGTATGCTATACTGCTGCTGATTTAATTGATATTATAAAAGTTAAACTAAAGTAAAGTTGGTTCTGCCAGTTGATTTTTATC
CAGTATACGGGAAGCATGATATCGGATAAATAAAGCTAGTTAAGCTACTGTACAGTGTACAGTAGCTTACAGTTTAAAAGATTTACTGAATCTGACTTTACCGTGTACTGTACAGTACAG
TACTTTTAGAGGTACAGTACCGTACAGTACCTCAGACCGCTTAGCTTTCTTAAATTGATGTACAGTACAGTACAAATAACGTCGAAAGTACCGCTGAAACGTCTCAAGTGTACTGTACTG
TAGAGCGACTTCATACTGTAATCAGGAAACTTTTAGGTGTAAAGTACAGTACAGTACGATCAAAACTTTTGACAACTACAGTACTGTACAGTAGAGTACAGTAGAGTTACGCCGTTCGTT
TCATCATGGCGGAAGAAGATGGCGGACGCAAGAAAAACAAGAATAAAGGCAATGTTTTACCTTTCCACGGAAGTGAAAAGACGATGAACTTAAATAATATGGTTTATACTAATATAATCT
CTTCTCCGTATTTTAAGAACGAACTATTTACCTTGAAAACATATCATGAAGTCGTGGACGAAATCTATTATAAGGTTTGTAAATTATGTTCCTTTATATTCTGCATTACATCTACTTAAA
TGCTGTAATTCTCAACTCGTCCGACTCGATTATACGATAAGTTCAATTGGATGGTGATCTATCGAATAGATATTATTACTACTGTATTAATATTGAATATTACTTTTATTTTTTAAATTT
ATTGTGTAAGGAAAATTATAATTTCATTTTATTGTTGTTAATGCATCCATATCTATATTTATGCACGTAATTTGGTTTGGTGTTGAAGGTAAACCATTTGGAGCCGTGGGAGAGAGGTAG
CAGAAATTTGTCAAATCAAGTCGGAATGTGTGGCGGAGTAAGTAAGAAAACTGTGATAAATCTATACGTATTTTTGTAAATTGGATGAAATACAGTGATCATGTAAGAACTGTTTTGCAC
TACTGTGGCGCGATTTACCGTATCATTATTAAGTGCTCTTTTGGTATACAGTATTGCATTACGAAACGCAACTGTTACCAGCTAGATTACTTTCATTTATCCAATGTTTTGAATTACAGG
CAAAAAGTAGGTAGTAGGTAGTACTGTATGTTAATCCTAGTTCAGCGGTTCATAGAACGCGCACTTGCTTAAACCATATCTATTTATAGTAACTTGTGCGGTGTGTTTCGCGAAATATCG
AATTATCCTGTAGTTGTACGGTATACTAAGTGTTAATGGTCTCGATATGCGGTTATTTATCAAGCCTGATATCAAAAAATTGAAGAATAACTTTTGAGTGAACCAATAACTTAGTAGCGG
ATCGATCTTATGAGATCACTGCGATTGCACCTTTTTTAACCGCAACATGTGAATATATGTACTTGAAAACGTAGTAAAATTTGAATTTCAATGCAGTCACATAATGTAGACAAAATGGCA
TCGACTTGTATTAGCATTTCGGAAGATTGAATCATGTAATACTGTTTTTGTAGTCTATACTAATAGTACTAACAATTTTCTACTACGGTATCGCACAATGGGAGTCATTATAACTAGTTT
TAGTAAGCATGTTTCAAAGATTTGCGGTTTTAATTAAGCCTTACTTATCATTACAGGTTCGTGGTGTTGGAACTGGCGGAATTGTATCAACCGCTTATTGTTTACTTTATAAATTATTTA
CTTTGCGTCTAACACGCAAACAGGTTAATGGTTTATTAACGCATTCTGATTCTCCTTATATTCGCGGTCTTGGTTTTATGTACATCAGGTAGCAATCGTACTTCATTATAAAGGAGTCAA
TCCTCATAATTATAGTAGTAGCTAGATACAGAGTAAGATTTACATGTAGTTCCATAATCTTGGTAGCGTGTTTTATATTACCTAGGAGAACAAATATGATAATAAAATGATATCCTATTA
ACGTACATATACGCAGATACACTCAACCACCGGCCGACTTATGGGATTGGTATGAATCTTACCTTGAGGATAATGAGGTTAGATACACTAACGATATAGCTTTTTAGCAGTTCTAAAGCT
TATTCATGTTTAAATTTTACTGTGTACAAGTATATAAGAATTATTAGAGCCCTAGTGCCATTAATTCAAGATAAATATTGCATATTCTATATCAGGAGCTCGATGTTAGAGCAGGTGGTG
GACAGTTGATTACTATTGGAGAGTTATGCGAAACAATGCTTTCAAAACTTGAATGGTTCAGTACATATTTTCCTCGTATACCTGTACCTGTACAAAAGGACATTAGGAATAAATTAGAGA
ACTATCGGCAGATCAAGAGAAAAACTCAGGAGACCTTGAGATCTCGAAGTTACGATAGACAATCTCCTACAGGACGTAGGAGTTCCGATCGCAGTGGCAACTTTGAGACAATTCAGCTCA
CTAAGAACAGTAAAACTAGAGATAGAGACCGTGATAGAAACAGAGCAAGTCTAAGTCCACATCAATCTAAAGAAGAACTTCATAGTAGAACAGACGACTATGTAAAACAGAAACATGTAA
GTAAAGAGCAAGCCAGTGAAAGCGCCAGTAAGGAAAGATTGAAGTATGGTCATAGTTATGAGCGGAGAAGGAGAAGCAGAAGTAGAGATCGATCTAGACGAAGCAAAGACGAAGGATCTC
ACAGTAGTCATTCAAAGAAAAGACATCGTAGTGGAGAAAAATACTCAGATAGAGATCATAAATACAGTAGGAGTAGAGATAAAAAACGCAATGACTATGACGAAATCAAATCTGTCGATA
AAAAAGAAAGTAGATACAGTTTAAGCAAGGAAAGATGTCTTGATAAATCTAGGAAGAGGGAGCAAAGCTCATGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAAAAAATTCCAGAGATAAGGCTGCCGATCAACTCAAAGAATTTCGTGAAAACAACGATCCTACTACTTTGACGACTAGTCATGGTGCTCCTGCTGAAAGTATCACTGATTCCGTT
ACAGTGGGACCTCGTGGACCTATTCTACTTCAGGATATTACTTTAATTGATCATATGGCTCATTTCGATCGTGAGCGTATCCCAGAGAGAGTTGTTCACGCTAAAGGAGCAG
GTGCATTC
GGCTACTTTGAGGTTACGCACGATATTACAAAATATTGTAAGGCGAAAGTATTTGAAAATGTCGGCAAACGTACACCTATGGCTGTACGTTTTTCCACCGTAG
GCGGCGAATCAGGAAGT
GCGGATACTGCTAGAGATCCTCGTGGGTTTGCCCTTAAATTCTATACGGAAGAGGGCAACTGGGATTTAGTTGGTAATAACACTCCAATTTTCTTTATAAGAGATCCCATCTTG
TTTCCT
AGTTTTATTCACACCCAAAAAAGAAATCCTGTAACCCATCTGAAG
GATCCTGACATGTTTTGGGATTTTATTAGCCTCCGACGAGAAACAACTCACCAGGTTTCCTTCTTGTTTACGGAT
CGCGGCACTCCGGATGGATACAGACACATGAATGGATACGGGAGTCATACATTCAAGCTAGTAAATGCAGACAACGAAGCTGTTTACTGCAAGTTTCATCTGAAG
ACTGATCAAGGCATT
AGGAATTTAACAGGAGAAAAAGCTCAAGAAATTAGTGGATTAGATCCCGATTATGCAATGAGAGATTTATATAACGCAATTGCCAGTGGAAACTCT
CCGTCTTGGACCATGTATCTTCAA
ATAATGACTTTTGAGCAGGCTGAGAAGTGGCGCTTTAATCCCTTTGATGTGACGAAA
ATTTGGCCTCATAGTGAATTTCCCTTGATTCCTGTTGGAAAAATGGTCTTGAACCGCAATCCG
AAAAATTATTTTGCCGAAGTGGAACAAATAGCTTTTGCTCCGGCTAATTTTGTTCCTGGAATAGAACCATCGCCTGATAAAATGCTGCAG
GGACGTTTGTTTTCTTATAATGATACTCAT
CGACATCGCCTTGGAACTAACTATGCTCAGTTACCTGTTAATTGTCCCTATGCAACGAAAGTTGGTAATTATCAAAGAGATGGTCCACAAACCTTCAATGACAACCACA
GTGGCGTTCCA
AACTATTATCCTAATAGTTTTAATGGTCCTATTGCAAATGTTAATAGAGCTACTCCACATACGGTCCAA
GTTATCGGTGATGTGAAACGCTATAATACAGCAGATGATGATAATTTTACA
CAAGTGACAGTATTTTGGCGAAAAGTTCTTAATGAGCAGGAGAGAACAGCATTGGTTAATAATATTGTGGGACATTTATGTATGGCACAATCGTTTTTACAGGAGCGGGCTATCGAAAAC
TTCTCGAAAGTTGACCCTGAGTACGGTAGAAGAATCAGAGAAGGATTAAATAGAAAA
GAAGAGGGAGCAAAGCTCATGTAG

Retrieve as FASTA