Entry information : SmaAPx-CcP01 (SMAC_02523 / SmaAPx-CcP01)
Entry ID 7297
Creation 2010-04-14 (Marcel Zamocky)
Last sequence changes 2010-04-14 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2013-04-10 (Christophe Dunand)
Peroxidase information: SmaAPx-CcP01 (SMAC_02523 / SmaAPx-CcP01)
Name (synonym) SmaAPx-CcP01 (SMAC_02523 / SmaAPx-CcP01)
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Sordariaceae Sordaria
Organism Sordaria macrospora    [TaxId: 5147 ]
Cellular localisation N/D
Tissue type Mycelium
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmaAPx-CcP01
start..stop
S start..stop
NcAPx-CcP01 1424 0 1..821 1..830
NdisAPx-CcP01 1422 0 1..819 1..813
NtetAPx-CcP1 1376 0 32..830 1..811
StheAPx-CcP01 1046 0 9..828 8..811
StheAPx-CcP01 209 2e-56 605..820 706..931
StheAPx-CcP01 195 8e-52 604..826 833..1057
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 19743..19966 224 N° 2 18649..19558 910 N° 3 18399..18593 195 N° 4 17328..18336 1009
N° 5 16994..17187 194  
complement(join(16994..17187,17328..18336,18399..18593,18649..19558,19743..19966 ))


exon

Literature and cross-references SmaAPx-CcP01 (SMAC_02523 / SmaAPx-CcP01)
Literature Nowrousian M., Stajich J., Chu, M., Engh I., Espagne E., Kamerewerd J., Kempken F., Knab B., Kuo H.C., Freitag M. (2010) De novo assembly of a 40Mb eukaryote genome from short sequence reads: Sordaria macrospora, a model organism for fungal morphogenesis. Plos Genet. 6: e1000891-e1000891.
Protein ref. UniProtKB_Uniparc:   D1Z5S4
DNA ref. GenBank:   CABT01000006.1 (19966..16994)
Protein sequence: SmaAPx-CcP01 (SMAC_02523 / SmaAPx-CcP01)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   843 (822)
PWM (Da):   %s   87556.67 (85383.5)  
PI (pH):   %s   4.87 (4.73) Peptide Signal:   %s   cut: 22 range:22-843
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKYNAYHALAGLLSLAARTGADPTWPAATDEMEEIVYQLQGFKGRVFNDIITPCNNEAAGPGRVTASEWLRVGFHDMATHNRVFGTGGLDASLQFELTNGENTGPGHNTTLKFFANYYSSQSTMSDLIAAGVYASVRSCGGPIIPLRLGRKDATSGGSTGVPQPQNSAETFRQQFDRMGFSTEEMIQVTACGHTLGGVHTEEFPEIVPVGTGTNGQKSLDTTDATFDNKVVTEYISGTTQNPLVVGPAVALNRHSDFKVYNIDGNATMNGLTSAENFRNVCKTVLQKMIDTVPSGVTLTDPIAPYAVKPVDMQLTLNSGGSSFLLTGYIRVRTTNRASGAIKNIKMTWKDRNGGCASGSCSYTATVQGAGTGFDDTFFYPISTNIPASSGISSFTVTINLNDGTSESYDNNGNSYPLSDAIILQKPQSCLLQTSGALTVSALVRNDITTTPSLGISYLTPRGVVRNGNPVPILSSATVAMTKGDCIGPYTFYSASYTIAGGLSYAAKLSVTAGSSSDSFNKASDLSGSCATFSGTASCTTPGSGGGDGGGNDPDASSTVASTAASSSAAEPSSTSSVVKEISSSDVPSSTTTTSSSTPTATGPARKLTVAGYTRLRCATEGSGVRALTGASFAYDTMTLESCAANCTGFAYFGTEYSRECFCGNTLASSSSEAPDSECNMLCAGDSTEYCGAGNRLELYSTTAGTGTGTATSSAAQPTATLGRKDAVGDYVFVGCQTEATQGGRALEGKFWADDGMTLEGCAEACEGWEYFGAEYGRECFCGNTLRGGSAPAPLADCSFTCAGNPYQYCGAGNRLELYRLASASSSSTKARKRTRGERARRL

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns). No EST available. Strain="k-hell". Peroxidase domain fused to 2 WSC domains (putative carbohydrate binding domain).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAATACAACGCATATCACGCCCTGGCCGGCCTGCTCTCGCTGGCGGCCAGGACTGGAGCCGACCCAACATGGCCCGCCGCCACGGACGAGATGGAGGAAATTGTGTACCAACTTCAG
GGCTTCAAGGGAAGGGTGTTCAATGATATTATCACGCCTTGCAACAATGAGGCTGCCGGGCCTGGAAGGGTGACGGCCTCGGAGTGGTTGCGGGTGGGATTCCA
GTATGTGATTTTTTAT
ATTTCTGTGGTGAGGGTTGGAGAACATGCCAAAAGGCGGAATAAAATCCAAAGGAAGTGAAAAAGAAGATTGGAAAGACACTTCATGGGAAACTCATATGTGATTTTGGGCACTTTGCTC
AAACTCAATGGATATTTGCCGTCTGCGCACATGCTAACTTCCGACCAGTGACATGGCCACCCACAACCGCGTCTTCGGCACCGGCGGGCTCGACGCCTCGCTTCAGTTCGAGCTCACAAA
CGGCGAGAACACCGGACCGGGCCACAACACCACCCTCAAGTTCTTCGCCAACTACTACTCATCCCAATCGACCATGTCCGACCTGATTGCCGCCGGAGTCTACGCCTCGGTCCGATCTTG
CGGAGGCCCCATCATCCCCCTTCGCCTCGGGAGGAAAGACGCAACATCCGGTGGCAGCACCGGCGTACCGCAACCCCAAAACTCGGCGGAAACGTTCAGGCAGCAGTTCGACCGCATGGG
GTTCAGCACCGAAGAAATGATCCAGGTGACGGCGTGCGGACATACCCTCGGCGGCGTCCACACGGAGGAGTTCCCCGAGATCGTACCCGTGGGTACGGGAACGAACGGCCAGAAGTCGCT
TGATACCACGGATGCCACGTTCGATAACAAGGTGGTTACCGAGTACATCTCTGGAACGACGCAGAACCCATTGGTGGTCGGCCCAGCTGTTGCGCTCAACAGACACTCGGATTTCAAGGT
GTATAACATTGATGGGAATGCCACGATGAACGGGCTGACTTCGGCTGAGAATTTTAGGAACGTCTGCAAGACTGTTCTCCAGAAGATGATTGACACTGTACCCTCGGGCGTGACGCTGAC
GGATCCTATTGCTCCCTATGCGGTTAAGCCTGTTGATATGCAGCTGACCTTGAACTCAGGAGGTAGCAGTTTTCTCTTGACCGGGTACATCAGAGTCCGCACAACAAACCGGGCTTCTGG
CGCCATCAAGAATATCAAGATGACTTGGAAGGATAGGAATGGGGGTTGCGCTTCCGGGTCGTGCTCATATACCGCCACCGTGCAAGGAGCTGGTACCGGGTTTGATGATACTTTTGAG
GT
ATGGTTCCTTTCTCGCTCGGACTCGGACTCATGATATCTAACCAAAGACATAGTTCTACCCTATTTCAACCAATATCCCCGCTTCCTCGGGCATCTCCTCGTTCACAGTGACCATCAACC
TCAACGACGGCACCAGCGAGTCCTACGATAACAACGGAAACTCCTACCCCTTGTCAGATGCCATCATCCTGCAAAAGCCCCAGAGCTGTCTCCTCCAGACTTCTGGTGCACTCACTGTTT
CTGCGCTC
GTAAGCTCCCACTCCCCCTCCTCCTCACCATCAAGACTCGCCTCCGCTGACTAACATAACAGGTCCGCAACGACATCACCACAACTCCCTCGCTAGGCATCTCCTACCTCAC
TCCCCGCGGCGTCGTCCGCAACGGTAACCCCGTCCCCATCCTCAGCAGCGCCACCGTCGCCATGACCAAAGGCGACTGCATCGGCCCCTACACTTTCTACTCCGCCAGCTACACCATCGC
CGGTGGCCTGAGTTACGCCGCCAAGCTCAGCGTCACGGCAGGTTCCAGCTCCGATAGCTTCAACAAGGCCAGCGATCTGTCAGGCAGCTGCGCCACCTTTTCGGGAACTGCGTCCTGCAC
CACGCCTGGTAGTGGTGGCGGTGATGGTGGTGGTAACGACCCAGACGCCTCTTCCACCGTTGCCAGCACCGCTGCTAGCTCATCGGCAGCCGAGCCATCATCAACCAGCAGCGTAGTCAA
GGAAATCAGCTCCAGCGATGTTCCCAGCTCTACCACCACCACTTCATCCTCAACTCCCACAGCCACCGGCCCCGCCAGAAAACTCACAGTGGCCGGCTACACCCGCCTCCGCTGCGCAAC
CGAAGGCTCGGGCGTGCGCGCCCTAACCGGCGCTTCCTTCGCCTACGACACCATGACGCTCGAATCCTGCGCCGCCAACTGCACAGGCTTCGCTTACTTCGGCACCGAATACTCGCGCGA
ATGTTTCTGCGGCAACACCCTGGCCTCTTCCTCCTCGGAGGCGCCCGATAGCGAATGTAACATGCTGTGCGCCGGTGATAGCACAGAGTATTGCGGAGCGGGAAACCGACTTGAGCTTTA
CTCTACCACTGCGGGCACGGGGACGGGTACGGCAACTAGTAGTGCAGCACAGCCGACGGCTACCCTGGGAAGAAAGGACGCCGTGGGCGATTACGTCTTTGTCGGATGCCAGACTGAAGC
TACTCAAGGCGGTAGGGCGCTGGAGGGCAAGTTCTGGGCTGATGACGGGATGACGCTCGAGGGGTGTGCGGAAGCTTGTGAGGGGTGGGAGTATTTCGGGGCGGAGTATGGGAGGGAGT
G
TGAGTTTTCTTTTTTCTTCTTTTTCTTTCTTCCTTTTTTTTTGTTTCTTTCTTCCTCTCTTCCCTCTTTCCTTTTCTCTCTTTTCCCTTTCCCATCTTATTTTGTGAGCTTGGTCAGCGC
TAACATGACGGTATGACAGGCTTCTGCGGCAACACCCTCCGCGGCGGTTCCGCTCCCGCTCCGCTGGCTGATTGCAGCTTCACTTGTGCCGGTAACCCGTATCAGTACTGTGGTGCTGGG
AACAGGCTTGAGCTTTATCGATTGGCGAGTGCCAGTTCATCATCGACGAAGGCTAGGAAGAGGACTCGTGGAGAGAGAGCGAGGAGGCTGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAATACAACGCATATCACGCCCTGGCCGGCCTGCTCTCGCTGGCGGCCAGGACTGGAGCCGACCCAACATGGCCCGCCGCCACGGACGAGATGGAGGAAATTGTGTACCAACTTCAG
GGCTTCAAGGGAAGGGTGTTCAATGATATTATCACGCCTTGCAACAATGAGGCTGCCGGGCCTGGAAGGGTGACGGCCTCGGAGTGGTTGCGGGTGGGATTCCA
TGACATGGCCACCCAC
AACCGCGTCTTCGGCACCGGCGGGCTCGACGCCTCGCTTCAGTTCGAGCTCACAAACGGCGAGAACACCGGACCGGGCCACAACACCACCCTCAAGTTCTTCGCCAACTACTACTCATCC
CAATCGACCATGTCCGACCTGATTGCCGCCGGAGTCTACGCCTCGGTCCGATCTTGCGGAGGCCCCATCATCCCCCTTCGCCTCGGGAGGAAAGACGCAACATCCGGTGGCAGCACCGGC
GTACCGCAACCCCAAAACTCGGCGGAAACGTTCAGGCAGCAGTTCGACCGCATGGGGTTCAGCACCGAAGAAATGATCCAGGTGACGGCGTGCGGACATACCCTCGGCGGCGTCCACACG
GAGGAGTTCCCCGAGATCGTACCCGTGGGTACGGGAACGAACGGCCAGAAGTCGCTTGATACCACGGATGCCACGTTCGATAACAAGGTGGTTACCGAGTACATCTCTGGAACGACGCAG
AACCCATTGGTGGTCGGCCCAGCTGTTGCGCTCAACAGACACTCGGATTTCAAGGTGTATAACATTGATGGGAATGCCACGATGAACGGGCTGACTTCGGCTGAGAATTTTAGGAACGTC
TGCAAGACTGTTCTCCAGAAGATGATTGACACTGTACCCTCGGGCGTGACGCTGACGGATCCTATTGCTCCCTATGCGGTTAAGCCTGTTGATATGCAGCTGACCTTGAACTCAGGAGGT
AGCAGTTTTCTCTTGACCGGGTACATCAGAGTCCGCACAACAAACCGGGCTTCTGGCGCCATCAAGAATATCAAGATGACTTGGAAGGATAGGAATGGGGGTTGCGCTTCCGGGTCGTGC
TCATATACCGCCACCGTGCAAGGAGCTGGTACCGGGTTTGATGATACTTTTGAG
TTCTACCCTATTTCAACCAATATCCCCGCTTCCTCGGGCATCTCCTCGTTCACAGTGACCATCAAC
CTCAACGACGGCACCAGCGAGTCCTACGATAACAACGGAAACTCCTACCCCTTGTCAGATGCCATCATCCTGCAAAAGCCCCAGAGCTGTCTCCTCCAGACTTCTGGTGCACTCACTGTT
TCTGCGCTC
GTCCGCAACGACATCACCACAACTCCCTCGCTAGGCATCTCCTACCTCACTCCCCGCGGCGTCGTCCGCAACGGTAACCCCGTCCCCATCCTCAGCAGCGCCACCGTCGCC
ATGACCAAAGGCGACTGCATCGGCCCCTACACTTTCTACTCCGCCAGCTACACCATCGCCGGTGGCCTGAGTTACGCCGCCAAGCTCAGCGTCACGGCAGGTTCCAGCTCCGATAGCTTC
AACAAGGCCAGCGATCTGTCAGGCAGCTGCGCCACCTTTTCGGGAACTGCGTCCTGCACCACGCCTGGTAGTGGTGGCGGTGATGGTGGTGGTAACGACCCAGACGCCTCTTCCACCGTT
GCCAGCACCGCTGCTAGCTCATCGGCAGCCGAGCCATCATCAACCAGCAGCGTAGTCAAGGAAATCAGCTCCAGCGATGTTCCCAGCTCTACCACCACCACTTCATCCTCAACTCCCACA
GCCACCGGCCCCGCCAGAAAACTCACAGTGGCCGGCTACACCCGCCTCCGCTGCGCAACCGAAGGCTCGGGCGTGCGCGCCCTAACCGGCGCTTCCTTCGCCTACGACACCATGACGCTC
GAATCCTGCGCCGCCAACTGCACAGGCTTCGCTTACTTCGGCACCGAATACTCGCGCGAATGTTTCTGCGGCAACACCCTGGCCTCTTCCTCCTCGGAGGCGCCCGATAGCGAATGTAAC
ATGCTGTGCGCCGGTGATAGCACAGAGTATTGCGGAGCGGGAAACCGACTTGAGCTTTACTCTACCACTGCGGGCACGGGGACGGGTACGGCAACTAGTAGTGCAGCACAGCCGACGGCT
ACCCTGGGAAGAAAGGACGCCGTGGGCGATTACGTCTTTGTCGGATGCCAGACTGAAGCTACTCAAGGCGGTAGGGCGCTGGAGGGCAAGTTCTGGGCTGATGACGGGATGACGCTCGAG
GGGTGTGCGGAAGCTTGTGAGGGGTGGGAGTATTTCGGGGCGGAGTATGGGAGGGAGT
GCTTCTGCGGCAACACCCTCCGCGGCGGTTCCGCTCCCGCTCCGCTGGCTGATTGCAGCTTC
ACTTGTGCCGGTAACCCGTATCAGTACTGTGGTGCTGGGAACAGGCTTGAGCTTTATCGATTGGCGAGTGCCAGTTCATCATCGACGAAGGCTAGGAAGAGGACTCGTGGAGAGAGAGCG
AGGAGGCTGTAG

Retrieve as FASTA