Entry information : ZmPrx39
Entry ID 735
Creation 2005-06-13 (Christophe Dunand)
Last sequence changes 2014-01-09 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-28 (Christophe Dunand)
Peroxidase information: ZmPrx39
Name ZmPrx39
Class Class III peroxidase    [Orthogroup: Prx013]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue types Glumes
Mycorrhizal roots
Ovaries
Silks
Inducers Fusarium infection
Glomus intraradices infection
Mycorrhiza
Pathogen interaction
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx39
start..stop
S start..stop
SbPrx115 610 0 2..357 3..357
SbPrx116 611 0 4..357 11..363
SpPrx01 603 0 2..357 3..357
ZmPrx03_F66 573 0 2..357 1..357
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..204 204 N° 2 362..814 453 N° 3 908..1321 414  
join(1..204,362..814,908..1321)


exon

Literature and cross-references ZmPrx39
Literature Singh,J.A. et al., unpublished
Protein ref. UniProtKB:   B4FVT1
DNA ref. GenBank:   AC188296.3 (169153..170473)
mRNA ref. GenBank:   BT041219
Cluster/Prediction ref. UniGene:   Zm.78825
Protein sequence: ZmPrx39
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   357 (336)
PWM (Da):   %s   37794.01 (35676.9) Transmb domain:   %s   i5-27o
PI (pH):   %s   8.09 (7.98) Peptide Signal:   %s   cut: 22 range:22-357
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTTRCCLVVATLLAALLSVSASLEFGFYNKTCPSAETIVQQTVAAAFTNNSGVAPALLRMHFHDCFVRGCDGSVLIDSTANNKAEKDSIPNSPSLRFFDVVDRAKASLEARCPGVVSCADILAFAARDSVVLTGGLGYKVPSGRRDGRISNATQALNELPPPFFNATQLVDNFASKNLSLEDMVVLSGAHTIGVSHCSSFAGINNTGDRLYNFSGSSDGIDPALSKAYAFLLKSICPSNSGRFFPNTTTFMDLITPAKFDNKYYVGLTNNLGLFESDAALLTNATMKALVDSFVRSEATWKTKFAKSMLKMGQIEVLTGTQGEIRRNCRVINPANAAADVVLARQPGSSGSTGVATS

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6, introns 1 and 3'), 118 ESTs and 1 mRNA. Containing IntR (3').

DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTACGCGCTGCTGCCTGGTCGTCGCCACTCTCCTCGCGGCGCTGCTCTCGGTCAGTGCCAGCCTCGAGTTCGGTTTCTACAACAAGACGTGCCCCAGCGCCGAGACCATCGTGCAG
CAGACCGTGGCCGCCGCGTTCACCAACAACTCCGGCGTCGCTCCGGCGCTCCTCCGCATGCACTTCCATGACTGCTTCGTCAGA
GTAAGCCCGCACATGCATGTTTATTCGTCATCAAAC
AAAAAGAAAAGTATCGTCTCCAGCCTTTTTGCATGACCTCACAGACTAGATTTATGATGATTTCCATGTCATAACTTTTCTCATCTAGAACAACACGACGTGGCCATTTGCATTATTGCA
GGGCTGCGACGGCTCGGTGCTGATCGACTCCACGGCCAACAACAAGGCGGAGAAGGACTCGATCCCCAACAGCCCGAGCCTGAGGTTCTTCGACGTGGTGGACCGCGCCAAGGCGTCCCT
GGAGGCGCGGTGCCCCGGCGTGGTGTCCTGCGCCGACATCCTCGCCTTCGCGGCCAGGGACAGCGTCGTGCTCACCGGCGGCCTCGGCTACAAGGTGCCGTCCGGACGCCGTGACGGCCG
GATATCCAATGCCACGCAGGCCCTGAACGAGCTGCCCCCGCCCTTCTTCAACGCCACCCAACTCGTCGACAACTTCGCCTCCAAGAACCTCAGCCTCGAGGACATGGTTGTCCTCTCCGG
CGCACACACCATCGGCGTCTCGCACTGCAGCAGCTTCGCCGGAATTAACAACACAGGCGACCGGCTCTACAACTTCAGTGGCTCATCCGACGGG
GTAAATTTCCCCTCCGACCATCTTCC
GTTCCCTAGATAGTTCTCATGTGATTATTATCCACTGCTACTGCTATATATATGGCCTACTATACAGATTGATCCTGCGCTGAGCAAAGCCTACGCGTTCCTCCTCAAGAGCATTTGCCC
GTCAAACAGCGGCCGGTTCTTCCCCAACACGACGACGTTCATGGACCTCATCACGCCGGCCAAGTTCGACAACAAGTACTACGTCGGCCTCACCAACAACCTGGGCCTCTTCGAGTCGGA
CGCGGCGCTGCTGACCAACGCAACCATGAAGGCGCTGGTCGACTCCTTCGTGCGCAGCGAGGCCACGTGGAAGACCAAGTTCGCCAAGTCCATGCTCAAGATGGGGCAGATCGAGGTGCT
CACGGGGACGCAGGGCGAGATCAGGCGCAACTGCAGGGTCATCAACCCTGCTAATGCCGCCGCCGACGTCGTCCTTGCCCGTCAGCCAGGTTCATCAGGATCCACTGGAGTGGCTACAAG
C

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTACGCGCTGCTGCCTGGTCGTCGCCACTCTCCTCGCGGCGCTGCTCTCGGTCAGTGCCAGCCTCGAGTTCGGTTTCTACAACAAGACGTGCCCCAGCGCCGAGACCATCGTGCAG
CAGACCGTGGCCGCCGCGTTCACCAACAACTCCGGCGTCGCTCCGGCGCTCCTCCGCATGCACTTCCATGACTGCTTCGTCAGA
GGCTGCGACGGCTCGGTGCTGATCGACTCCACGGCC
AACAACAAGGCGGAGAAGGACTCGATCCCCAACAGCCCGAGCCTGAGGTTCTTCGACGTGGTGGACCGCGCCAAGGCGTCCCTGGAGGCGCGGTGCCCCGGCGTGGTGTCCTGCGCCGAC
ATCCTCGCCTTCGCGGCCAGGGACAGCGTCGTGCTCACCGGCGGCCTCGGCTACAAGGTGCCGTCCGGACGCCGTGACGGCCGGATATCCAATGCCACGCAGGCCCTGAACGAGCTGCCC
CCGCCCTTCTTCAACGCCACCCAACTCGTCGACAACTTCGCCTCCAAGAACCTCAGCCTCGAGGACATGGTTGTCCTCTCCGGCGCACACACCATCGGCGTCTCGCACTGCAGCAGCTTC
GCCGGAATTAACAACACAGGCGACCGGCTCTACAACTTCAGTGGCTCATCCGACGGG
ATTGATCCTGCGCTGAGCAAAGCCTACGCGTTCCTCCTCAAGAGCATTTGCCCGTCAAACAGC
GGCCGGTTCTTCCCCAACACGACGACGTTCATGGACCTCATCACGCCGGCCAAGTTCGACAACAAGTACTACGTCGGCCTCACCAACAACCTGGGCCTCTTCGAGTCGGACGCGGCGCTG
CTGACCAACGCAACCATGAAGGCGCTGGTCGACTCCTTCGTGCGCAGCGAGGCCACGTGGAAGACCAAGTTCGCCAAGTCCATGCTCAAGATGGGGCAGATCGAGGTGCTCACGGGGACG
CAGGGCGAGATCAGGCGCAACTGCAGGGTCATCAACCCTGCTAATGCCGCCGCCGACGTCGTCCTTGCCCGTCAGCCAGGTTCATCAGGATCCACTGGAGTGGCTACAAGC

Retrieve as FASTA