Entry information : HaAPx02 (HanXRQChr02g0044461)
Entry ID 7353
Creation 2010-05-26 (Christophe Dunand)
Last sequence changes 2016-04-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaAPx02 (HanXRQChr02g0044461)
Name (synonym) HaAPx02 (HanXRQChr02g0044461)
Class Ascorbate peroxidase    [Orthogroup: APx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaAPx02
start..stop
S start..stop
HpAPx01 508 0 1..250 1..250
HarAPx01 506 0 1..250 1..250
HaAPx01 498 0 1..250 1..250
GhyAPx01 478 6e-174 1..250 1..250
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 100744113..100744231 119 N° 2 100743525..100743699 175 N° 3 100743381..100743446 66 N° 4 100743240..100743288 49
N° 5 100743074..100743159 86 N° 6 100742911..100742990 80 N° 7 100742731..100742833 103 N° 8 100742565..100742623 59
N° 9 100742470..100742485 16  
complement(join(100742470..100742485,100742565..100742623,100742731..100742833,1 00742911..100742990,100743074..100743159,100743240..100743288,100743381..1007434 46,100743525..100743699,100744113..100744231))


exon

Literature and cross-references HaAPx02 (HanXRQChr02g0044461)
Literature Michelmore,R.W., Knapp,S., Rieseberg,L., Bradford,K., Kesseli,R., Boore,J., Kozik,A., Matvienko,M., Lavelle,D. and Lai,Z. Sunflower (Helianthus annuus) ESTs (set 2) from the Compositae Genome Project http://compgenomics.ucdavis.edu/.
DNA ref. HanXRQ genome:   HanXRQChr02 (100744231..100742470)
EST ref. GenBank:   DY913625.1
Cluster/Prediction ref. HanXRQ:   HanXRQChr02g0044461 UniGene:   Han.4442
Protein sequence: HaAPx02 (HanXRQChr02g0044461)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   250
PWM (Da):   %s   27440.95  
PI (pH):   %s   5.41
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGKSYPCVSEEYKKAVDKARKKLRGFIAEKRCAPLMLRLAWHSAGTFDVNTKTGGPFGTMRYKAELSHGANNGLDIAVRLLEPIKEQFPILSYGDFYLAGVVAVEVTGGPEVPFHPGREDKEEPPVEGRLPDATKGNDHLRDVFVKTMGLEDIDIVTLSGGHTGAAHKERSGFEGPWTPNPLIFDNSYFTELLAGEKEGLLKLPTDKALLEDPVFRPLVEKYADEDAFFADYAVSHMKLSELGFADA

Retrieve as FASTA  
Remarks Complete sequence from genomic and 7 ESTs. Strain="ANN1312"
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAAAGAGCTATCCATGTGTTAGTGAGGAGTACAAGAAGGCTGTTGATAAAGCCAGGAAGAAGCTCAGAGGATTCATTGCTGAGAAGAGATGTGCTCCTTTGATGCTCCGTCTTGCG
TAAGTTTTACGATCATTTTATGCATTATTTATGTGATTTCGGTTTAAGGAAATAGGAGTTTTGTGTTTATCATTTTCTGCATCTGTTTTGATCATGCTAACATGCCTCTGGAAATGATGG
TTATCCGATAAATCTTTTAGAGTAGTTAGTTCACTTTTAACAATTTTTTGTACATCTGAACAAGGAGATGCACTCCACTTATTGATATAAAATGGATTTTTTATGAATCAAATATTGTGG
ATCCTGGATATAATTATTCAGTAACACTGGCCCGTTATTTCAAATCATAATCATATAATTAGTTTCTAAAACAAATGTTTCTTTACTTGGAATGAATTACTCTATACCCGATTGGCCAAT
TTTATGAACATATCCTGAAGTCTTTCACTTATATCCTCATAATGGGCTACAGATGGCACTCTGCTGGTACTTTTGACGTGAACACCAAAACCGGAGGTCCTTTTGGTACCATGAGGTACA
AGGCTGAGCTAAGCCATGGTGCCAACAACGGTCTTGACATTGCTGTCAGGCTGCTGGAGCCTATTAAGGAGCAATTCCCCATCCTCTCATATGGTGATTTCTATCAG
GTAATTTAAAATC
TTTTATGCAAATACTTCCGGTCTGGATTAACTAGTTGGTGCTGATATGCTTATCCTTTATTGTAGTTGGCTGGTGTTGTTGCTGTCGAAGTTACCGGAGGACCTGAAGTTCCTTTCCATC
CCGGAAGAGAG
GTTCGTGTTATTTCCATCAAATTGTCAATTGATTCTGTTTAAATTCTATATTGTTTTAAAATGCATCGTTATGTTCTAATTTGTTTTTCCAGGACAAAGAAGAGCCACC
AGTTGAAGGCCGTCTTCCTGACGCAACAAAGG
GTTAGTGAGTTTGATATCTTCAAAGTTTTTGATGATTAACAATGTGAAGTCTTGAAGTTGTTAGATATGTTAACTTGCAGGAAACGAC
CATCTGAGGGATGTGTTTGTTAAGACCATGGGCCTTGAAGATATCGACATTGTAACTCTATCTGGTGGCCATACTCTG
GTTGGTTCAATACATCTGTTGTTTTATTCATCGTTATGATTG
ATCACTGCAAATTTCTAATGATTAAGTGTAACCGTTTATAGGGAGCTGCCCACAAGGAGCGATCTGGATTCGAGGGACCATGGACTCCCAATCCTCTTATCTTCGACAACAGCTACTTCA
C
GTGAGTTTTTCTTTATGTTTCTGTCTTCGTTTGATTCTTGTTATAATCAAATTCTAAAAGGGATCTGTTTTGAACAGTGAACTTCTTGCTGGTGAGAAAGAGGGGCTCCTGAAGCTACC
CACCGACAAAGCTCTTCTTGAGGACCCTGTATTCCGACCGTTGGTTGAGAAATATGCTGCT
GTGAGTACAACTTATACCACCAGAACATATATATCAATATATCATAAATATAAGTGGAT
GCTTAGTTTTTTTTTTTTTTTTTTTTTTTTGTTTTGGATTTGAATCAGGATGAGGATGCATTCTTTGCTGATTATGCAGTTTCACACATGAAACTCTCCGAGTTGGGGTAAATATTCAAC
TTTTTGGTTTTATATCTGCCATATAAATTCCATTTGTGCTGACAAATTTGTTTGGAACTATTGCAGATTTGCTGATGCCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAAAGAGCTATCCATGTGTTAGTGAGGAGTACAAGAAGGCTGTTGATAAAGCCAGGAAGAAGCTCAGAGGATTCATTGCTGAGAAGAGATGTGCTCCTTTGATGCTCCGTCTTGCA
TGGCACTCTGCTGGTACTTTTGACGTGAACACCAAAACCGGAGGTCCTTTTGGTACCATGAGGTACAAGGCTGAGCTAAGCCATGGTGCCAACAACGGTCTTGACATTGCTGTCAGGCTG
CTGGAGCCTATTAAGGAGCAATTCCCCATCCTCTCATATGGTGATTTCTATCAG
TTGGCTGGTGTTGTTGCTGTCGAAGTTACCGGAGGACCTGAAGTTCCTTTCCATCCCGGAAGAGAG
GACAAAGAAGAGCCACCAGTTGAAGGCCGTCTTCCTGACGCAACAAAGGGAAACGACCATCTGAGGGATGTGTTTGTTAAGACCATGGGCCTTGAAGATATCGACATTGTAACTCTATCT
GGTGGCCATACTCTG
GGAGCTGCCCACAAGGAGCGATCTGGATTCGAGGGACCATGGACTCCCAATCCTCTTATCTTCGACAACAGCTACTTCACTGAACTTCTTGCTGGTGAGAAAGAG
GGGCTCCTGAAGCTACCCACCGACAAAGCTCTTCTTGAGGACCCTGTATTCCGACCGTTGGTTGAGAAATATGCTGCT
GATGAGGATGCATTCTTTGCTGATTATGCAGTTTCACACATG
AAACTCTCCGAGTTGGG
ATTTGCTGATGCCTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTGTGGTAT ATTCGCCCAG AAATTTTGAT TTCCTGTGCC ACATTTTCCA CCAAACCCCA TCTAAACCAA TCCTGTCCGT TGAAACAATT CTTGACTAAA GATCACTCTA TCCAACGGCC  ACAAATAAGT ACTGGAAACT TCGCTATTTT CCAATCCAAC CCCTATATAA TGGCAGTGCT TGTGGCTCTC TCGTGCTCAG TCATCACTCT CTAGGGTTTC TCGTTGATCA TATTATATCT  TGATAATATT CCGGTTGAAC AGGTTTTGTT CATGAAGGTG TGTGTTTATG AATTTGAAAA CCATGGGAAA GAGCTATCCA TGTGTTAGTG AGGAGTACAA GAAGGCTGTT GATAAAGCCA  GGAAGAAGCT CAGAGGATTC ATTGCTGAGA AGAGATGTGC TCCTTTGATG CTCCGTCTTG CATGGCACTC TGCTGGTACT TTTGACGTGA ACACCAAAAC CGGAGGTCCT TTTGGTACCA  TGAGGTACAA GGCTGAGCTA AGCCATGGTG CCAACAACGG TCTTGACATT GCTGTCAGGC TGCTGGAGCC TATTAAGGAG CAATTCCCCA TCCTCTCATA TGGTGATTTC TATCAGTTGG  CTGGTGTTGT TGCTGTCGAA GTTACCGGAG GACCTGAAGT TCCTTTCCAT CCCGGAAGAG AGGACAAAGA AGAGCCACCA GTTGAAGGCC GTCTTCCTGA CGCAACAAAG GGAAACGACC  ATCTGAGGGA TGTGTTTGTT AAGACCATGG GCCTTGAAGA TATCGACATT GTAACTCTAT CTGGTGGCCA TACTCTGGGA GCTGCCCACA AGGAGCGATC TGGATTCGAG GGACCATGGA  CTCCCAATCC TCTTATCTTC GACAACAGCT ACTTCACTGA ACTTCTTGCT GGTGAGAAAG AGGGGCTCCT GAAGCTACCC ACCGACAAAG CTCTTCTTGA GGACCCTGTA TTCCGACCGT  TGGTTGAGAA ATATGCTGCT GATGAGGATG CATTCTTTGC TGATTATGCA GTTTCACACA TGAAACTCTC CGAGTTGGGA TTTGCTGATG CCTAAAGTTT GTGATGGAGT GGGGGCGACC  TGTTTGGCAA TTATATTTTG AGTGTTAAAG TGTTTTTGTT TTGTTTGTCA AGAGATTAAA AAACACACTG TGAAGCATAT GAGACCCTCT TGAGTTGGGG TTGCAGTTTG ATTAATGAAG  TATTCAGCCT TGATTTATAA TTTTCTTAAT CTTGAATTTC TCCTATTATT ACTAATTATT TGCATTTGAA AAGGCCTTAG CGTTTGTTAA ATACCGTTAC TAGGTTTTTG TTATTTGTAC  TTGTAATCGG GGATAACTGA ATGCTGTTAG GCCTATAAAC CAATGAACAC CAAAAACGTA TCTGTATTGC TTATTTTTAC TTGGGCTTTA CTCCTCTTAC AGTTAAAACT GGTCTTCAAT 
AATTCAAGGA AAAAACAACA GTAGACAAAT ACAACAACGG TAGACAAATA CAACTGAA 

Retrieve as FASTA