Entry information : HaPrx07 (HanXRQChr15g0470621/ HaT13l000345_1)
Entry ID 7355
Creation 2010-05-26 (Christophe Dunand)
Last sequence changes 2016-04-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx07 (HanXRQChr15g0470621/ HaT13l000345_1)
Name (synonym) HaPrx07 (HanXRQChr15g0470621/ HaT13l000345_1)
Class Class III peroxidase    [Orthogroup: Prx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx07
start..stop
S start..stop
HpPrx01-1 680 0 1..331 1..331
HarPrx01 665 0 1..331 1..328
HaPrx06 652 0 1..331 1..328
LperPrx05 651 0 1..331 1..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 24069803..24070033 231 N° 2 24070297..24070485 189 N° 3 24072358..24072523 166 N° 4 24072947..24073356 410
join(24069803..24070033,24070297..24070485,24072358..24072523,24072947..24073356 )


exon

Literature and cross-references HaPrx07 (HanXRQChr15g0470621/ HaT13l000345_1)
DNA ref. HanXRQ genome:   HanXRQChr15 (24069803..24073356)
EST ref. GenBank:   DY917909.1 [5' end]   BQ914415.1 [3' end]
Cluster/Prediction ref. HanXRQ:   HanXRQChr15g0470621 UniGene:   Han.2159
Protein sequence: HaPrx07 (HanXRQChr15g0470621/ HaT13l000345_1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (310)
PWM (Da):   %s   37186.16 (34954.8)  
PI (pH):   %s   8.55 (8.39) Peptide Signal:   %s   cut: 22 range:22-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPKTLIFFALFSLLAIVALADTESTQSDSGLMLNFYKDTCPQAEDIIREQVGLLYKRHKNTAFSWLRNIFHDCAVESCDASLLLDSTRRSLSEKETDRSFGLRNFRYLETIKEALERECPGVVSCADILVLSGRDGIVALGGPYIPLKTGRRDGRKSRAEILEQYLPDHNESMSVVLERFKNMGIDTPGVVALLGSHSVGRTHCVKLVHRLYPAVDPVLDPGHVEHMLHKCPDAIPDPKAVQYVRNDRGTPMKLDNNYYRNILDNKGLLIVDHQLANDKRTKPFVKKMAKSQDYFFKHFGRAVTILTENNPLTGTQGEIRKQCNVANKHH

Retrieve as FASTA  
Remarks Complete sequence from genomic and 34 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCCCAAAACTCTCATCTTCTTTGCTCTCTTCTCCCTCTTAGCCATTGTTGCACTTGCAGACACTGAGTCAACCCAGTCTGACTCAGGTCTCATGCTCAACTTCTACAAAGACACA
TGCCCACAAGCTGAAGATATCATCAGAGAACAAGTTGGGCTTCTTTACAAACGCCACAAGAACACTGCTTTCTCTTGGCTCAGAAACATCTTCCATGATTGTGCTGTTGAG
GTACAACTC
TTACCACTGCGGATCTAGAAAATCCTTATAGACGCAACGTTTAAAAAAAAAGTAACAAAATCGAAAAAACGTCAATTTTTTTTTTCCAAAATTTACACTAACGTCGGAGCGTCAAGGTTA
CTCCACAATATACTACATAACTTTTTTTATATTTCGTTACCAGTGACGAAACCAGAACTTTTTAGTCAGACGTGTTTTTTTTATAAAAAAGTATATTTTGTTATATGAAAATCTAACAAA
TTTTATGGACACAGTCATGTGATGCTTCACTGCTTCTGGACTCAACAAGGAGGTCACTCTCTGAGAAAGAGACAGACAGGAGCTTTGGGCTTAGAAATTTCAGGTATCTTGAAACCATCA
AGGAAGCTTTGGAGAGGGAGTGCCCAGGAGTTGTATCTTGTGCAGATATACTTGTACTCTCTGGAAGGGATGGAATTGTTGCG
GTAAATTCTGTTTTTTATTCTTTTCTGGAATCACAAG
AAAAAAAAAAGTTAGAAAAAGGCAAATAAGACCGTCGGTTAAAACACTAAAGCGTGGGCTAAATTTTAGAGAGAGAAAAAACTAAAAAGTAAAATAGGGATCACGAAAAATTAATCAAAA
TAATACATGTGTAAAGTAGGGATGAGCATATGCCACCGAATACCGATCCCATACCGATCCCGTACCAATCCCGATCCTGATCGGTATCCCGATCGGTATCCACTTTTTGGCGTTTTCGGT
ATCGGTACGGTACGGTATCGGTATTATACCGATACCGACCCTCAAAATACGGTATAATACCGATACCGTACCGTATCGATACCTAACCGACATGTTTCGGTATCGGTATCGGTACCTAGT
TTGGGTGAAATTCGGGATCGGTATTAGGCGGTATCGGTATCGGTTCGGTATCGGATACCGATATGCTCATCCCTAGTGTAAAGAGCTTGCCAAATTTAGTTGGCGGCAAAAATTTAGCCT
ACACTTTTTTAGCCGCAGGCTAAATTTTAGTTTTCAAAAAAAGCGTAGGAGCCTTAGCTGACACTTTTTTTAAACGAATACAAAGAGAATACATGTAAAGCGTGAGCTAAATTTTAATTG
TTTTAGCCGGCACTTTATTTATTTTGTTAAGAACTAAGTCAATATTCATTTCGGTAAGTTTTTTGTCTAACATGTTGATTTGTACTGTTTTTTTTTTTTTTTTTTTTTTATGTGGTAACT
TTCTGCATGCATTACTTGGCTGTACACTTGTCAGTTTTCTTTGCAAGTAATCTTTCTTGTCGGTGTTTTACTATTTTTGGATATCCCTAAAGGAAATCTTGAAGTGATATCCACTCAACA
TTTTGTGTCACTAATTAGTTATAACTTTGTTTAGTCCATCTCTTCAAGAAGTCTTGATTAGGATAATACTCTTATGATTATGATTATGATTATGTTTATGATTATGAACATGATCATATT
TTTTTTTTGAACGGCGAAAACTTCTATATACATATATATGTTATATGTATGTTATGTTTTAGTTAGTTGTACTTTCGTTGGTCATCTCATCATAAAATCTTGATTTGGATTCTCCTATGA
ATAGCATATGTTATGCATGAGTTGGTCAAGCGTACTCTCTATGTAACTGTTATTGCAATAATTGAAGTTGTGAAGAAAAAGAAAATCAAATAGAGTGACAGTTTGCAATAATTGAAGTTG
TGAAGAAACAGAAAATCAAAGAGAGCGACAATTAAATCAATCCAAATAAATAATTATGCAAATGCTTGTAATTTAAGCAATAAAGTATAGTTTTTTTTTTTTTTTTGTCCATTTCGGCTC
TAAAAACTTGTCTTGTCTAGTGGCATACGCACAAATGATTTGTGTATTCTTTTTAGTTTTCTTCTTTAATTGATACATGCATCATTCATTCATTAATATATTATACTATTAACGTCAAAC
TAAATTTTTTCTTTAAACATTTAATTTGTAAAAGGGTAAAATAGTAATAATCCATGCAACTTTTATCGTACAAATCACATTTATTAGTTGTACTTGGTGATCCATTACTTCTTGTACTTC
TAGTTAGTGTGCTACCCTGTAAGCAAACGAACTCAGCAAGTGCGCTTGATGGCAATCGAACTCCGTAAAAGTATGGTGAAACAATTTATGGAGTTCGATTGCCACCAAATTCGCTTACAA
GGTAGCGACATGACTAGAAGTACAAGTCTCGTTCCTAAACAAACCTACTTCTACACACAAAAAAAAAGTCAGATTTTTTGATTTTTTTTAGCTGGTTGTACACACACTAGCAATATTGAT
GTGTAATATGTGTTCTTGATTTTGATATATGACAGCTTGGTGGGCCATACATACCTCTAAAAACAGGGAGAAGGGATGGTAGGAAGAGTAGAGCAGAGATTTTGGAGCAATATCTTCCAG
ATCATAATGAGAGCATGTCTGTGGTTCTTGAAAGGTTCAAGAACATGGGCATTGACACCCCTGGAGTTGTTGCTTTACTAG
GTATGTATCATCATCATACATCATATAGAGCAGGGGCGG
AGGTAGTGTACAAGCAGGGGTAGCACAGGCTACCCCTCAACTTCATCTACATAGTTTATTTATTTATTTTATTTTTCTAGTTTTATAGAAAAGATTCACCTGATCTCAAAAAAAATTGGG
ATACCCTTGAATTTTTTTATTTATGATTAGAGGCAAGCTAGTACCCAGAGTTGGTTTTCTATATATGTGTGCATCGTATTGTATGACGTGTGCACACATGTAGAGGTAGGTAGCTTTTGT
ATGTGTTGCCCACGTCTAGTCATTGAGACTCATGGGCACACATGTATATGCATGATGCATATTGCATGATGCATATTGCATGATGCATATCCCATCAAAAAGTATGTATTTTTTTATAAC
ATAACGGCGGTTTTCTTGTAACAGGTTCTCACAGTGTGGGTAGGACACATTGCGTGAAGCTCGTGCACCGTCTATATCCCGCGGTGGACCCGGTTCTTGACCCAGGTCATGTTGAGCACA
TGCTCCACAAGTGCCCGGACGCAATCCCAGACCCGAAGGCCGTTCAATACGTGAGAAATGACCGTGGTACCCCTATGAAACTCGACAACAATTACTACCGAAACATATTGGACAACAAGG
GTTTGTTGATTGTGGACCACCAATTGGCAAATGACAAGAGAACTAAACCATTTGTGAAGAAAATGGCAAAGAGCCAAGATTATTTCTTTAAGCATTTTGGAAGAGCCGTTACCATTCTGA
CTGAGAACAATCCACTCACTGGCACTCAAGGTGAAATCAGAAAACAATGCAATGTTGCAAACAAACACCATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCCCAAAACTCTCATCTTCTTTGCTCTCTTCTCCCTCTTAGCCATTGTTGCACTTGCAGACACTGAGTCAACCCAGTCTGACTCAGGTCTCATGCTCAACTTCTACAAAGACACA
TGCCCACAAGCTGAAGATATCATCAGAGAACAAGTTGGGCTTCTTTACAAACGCCACAAGAACACTGCTTTCTCTTGGCTCAGAAACATCTTCCATGATTGTGCTGTTGAG
TCATGTGAT
GCTTCACTGCTTCTGGACTCAACAAGGAGGTCACTCTCTGAGAAAGAGACAGACAGGAGCTTTGGGCTTAGAAATTTCAGGTATCTTGAAACCATCAAGGAAGCTTTGGAGAGGGAGTGC
CCAGGAGTTGTATCTTGTGCAGATATACTTGTACTCTCTGGAAGGGATGGAATTGTTGCG
CTTGGTGGGCCATACATACCTCTAAAAACAGGGAGAAGGGATGGTAGGAAGAGTAGAGCA
GAGATTTTGGAGCAATATCTTCCAGATCATAATGAGAGCATGTCTGTGGTTCTTGAAAGGTTCAAGAACATGGGCATTGACACCCCTGGAGTTGTTGCTTTACTAG
GTTCTCACAGTGTG
GGTAGGACACATTGCGTGAAGCTCGTGCACCGTCTATATCCCGCGGTGGACCCGGTTCTTGACCCAGGTCATGTTGAGCACATGCTCCACAAGTGCCCGGACGCAATCCCAGACCCGAAG
GCCGTTCAATACGTGAGAAATGACCGTGGTACCCCTATGAAACTCGACAACAATTACTACCGAAACATATTGGACAACAAGGGTTTGTTGATTGTGGACCACCAATTGGCAAATGACAAG
AGAACTAAACCATTTGTGAAGAAAATGGCAAAGAGCCAAGATTATTTCTTTAAGCATTTTGGAAGAGCCGTTACCATTCTGACTGAGAACAATCCACTCACTGGCACTCAAGGTGAAATC
AGAAAACAATGCAATGTTGCAAACAAACACCATTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CTTCGGCCGG GGCCCATTAC CAAAGAGAGC AAAATGGCTC CCAAAACTCT CATCTTCTTT GCTCTCTTCT CCCTCTTAGC CATTGTTGCA CTTGCAGACA CTGAGTCAAC CCAGTCTGAC  TCAGGTCTCA TGCTCAACTT CTACAAAGAC ACATGCCCAC AAGCTGAAGA TATCATCAGA GAACAAGTTG GGCTTCTTTA CAAACGCCAC AAGAACACTG CTTTCTCTTG GCTCAGAAAC  ATCTTCCATG ATTGTGCTGT TGAGTCATGT GATGCTTCAC TGCTTCTGGA CTCAACAAGG AGGTCACTCT CTGAGAAAGA GACAGACAGG AGCTTTGGGC TTAGAAATTT CAGGTATCTT  GAAACCATCA AGGAAGCTTT GGAGAGGGAG TGCCCAGGAG TTGTATCTTG TGCAGATATA CTTGTACTCT CTGGAAGGGA TGGAATTGTT GCGCTTGGTG GGCCATACAT ACCTCTAAAA  ACAGGGAGAA GGGATGGTAG GAAGAGTAGA GCAGAGATTT TGGAGCAATA TCTTCCAGAT CATAATGAGA GCATGTCTGT GGTTCTTGAA AGGTTCAAGA ACATGGGCAT TGACACCCCT  GGAGTTGTTG CTTTACTAGG TTCTCACAGT GTGGGTAGGA CACATTGCGT GAAGCTCGTG CACCGTCTAT ATCCCGCGGT GGACCCGGTT CTTGACCCAG GTCATGTTGA GCACATGCTC  CACAAGTGCC CGGACGCAAT CCCAGACCCG AAGGCCGTTC AATACGTGAG AAATGACCGT GGTACCCCTA TGAAACTCGA CAACAATTAC TACCGAAACA TATTGGACAA CAAGGGTTTG  TTGATTGTGG ACCACCAATT GGCAAATGAC AAGAGAACTA AACCATTTGT GAAGAAAATG GCAAAGAGCC AAGATTATTT CTTTAAGCAT TTTGGAAGAG CCGTTACCAT TCTGACTGAG  AACAATCCAC TCACTGGCAC TCAAGGTGAA ATCAGAAAAC AATGCAATGT TGCAAACAAA CACCATTGAA GAAATGAAAA AGCTGTTTTA GTTTGTGCTT TGGTAATGAT GGTGTTAGTG 
ATGATGATGA TGATGTGGAG AATAAGAAGA TGATGATGAT GGTGTGAGCA TGCATCATGA TGGCTTCCAA TGTCTAAGAT GGATGT 

Retrieve as FASTA