Entry information : HaKat05(HanXRQChr12g0367681)
Entry ID 7367
Creation 2016-05-11 (Christophe Dunand)
Last sequence changes 2016-05-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2020-01-31 (Catherine )
Peroxidase information: HaKat05(HanXRQChr12g0367681)
Name HaKat05(HanXRQChr12g0367681)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaKat05
start..stop
S start..stop
HaKat08 971 0 1..492 1..502
HaKat01 874 0 1..492 1..492
McKat01 870 0 1..490 1..490
HaKat06 861 0 1..492 1..492
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 47536111..47536125 15 N° 2 47540139..47540235 97 N° 3 47540300..47540577 278 N° 4 47548051..47548827 777
N° 5 47548908..47548997 90 N° 6 47549232..47549299 68 N° 7 47549377..47549530 154  
join(47536111..47536125,47540139..47540235,47540300..47540577,47548051..47548827 ,47548908..47548997,47549232..47549299,47549377..47549530)


exon

Literature and cross-references HaKat05(HanXRQChr12g0367681)
Cluster/Prediction ref. HanXRQ:   HanXRQChr12g0367681
Protein sequence: HaKat05(HanXRQChr12g0367681)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   492
PWM (Da):   %s   56733.19  
PI (pH):   %s   7.25
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPYKQRPSSAYNTPFWTTNAGAPVYNNTASLTVGNRGPILLEDYHLIEKLANFTRERIPERIVHARGASAKGFFEVTHDITHLTCADFLRAPGVQTPVIVRFSTVIHERGSPETIRDPRGFATKFYTRGNFDIVGNNFPVFFTRDAMAFPDVIHAFKPNPKSHIQEDWRILDFLSHHPESLNTMTFWLDDVGIPTDYRHMEGSSVNTLTLVNKEGKMHYVKFTWKPTCGVKCLMDDEAIKIGGANHSHATQDLYDSIQAGNFPEWKLFLQVIDPDHEDRLDFDPLDGTMTWPEDVIPLQPVGRMVLNKNIDNFFAENEQLAFNPGLVVPGIYYSDDKMLQGRIFAYSDTQRHRLGPNYLQLPVNAPKCAHHNNHYDGHMNFMHRDEEVDYFPSRYDRVQHAQKYPINPARVTGTRDRTVIPKYNDFKQPGERYRSWDPARQERFIVRMCKMLSDPRVTHELRSIWISYWTQADKSLGQKIASRLNVRPNY

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCCTACAAGGTAAACCTCTATGATGGTGATCAAATTTAGTTTGTTTATAGTGAAATTTCAGTACGAAGATCTTCATGCTCACACTACACATAACACGATGCCAAAATTTATTTT
TATCGTGTTAGATTTGTCATTTTATTGTGTGTGTATTGAGTTAGTTTCTATGAGGTATATCGCACTTATAGCTTGAGTGATATGAATGATAATTTGAGTCGTTGCTTTAAGCTTATACAA
GTTTATATAATACAAACGCGTTTGCATCCGATCTTGCTTGACTAAGATTCAAGAGAATTTTATCTGATCTACTTCATTAGTCACGGTCATCCCCACTTTCTCATCTGCTTAATATTGTTC
TCGTTTAAACATACTCGATACATGTATATAGATAGACAAATACGTAAATACCTATAAATTTGTTGAAAATGATATTTTCTACTTATTATAAACTTAATTACACATTATTAATTAGTAGGT
TTGATTAAGTACAGGTTTTTTTTCGGGATGTTGAGTGTTCATTATATGAACTAACTAGGTTAGAACCCCGTGTATTACACGGGTTGAATAAATGTAATTTTATATATTAAATAATAAAAA
GTTATATCTTTCTGAACCCCGTATATTGTACGGGTTAAATGAATATAATTTTATATATCAAATAATAAAAATAGTTATATCTTTAAAAACCATGTGTATTACACAGATTAAATAAATGTA
ATTTTGTATACTACATACTAAAAACGTCGCATCTTTAAAAAACCCGTGTATAATCAGGTTGAATAAATCTACCAAATAATAAAAATATTACATCCTTAAAAACCTCGTATGTTACACATG
TTGAATAGATCCGAAAAAGAGTTATATATTTAAAAACCATGTGTATTCCACATATTAAATAAATGTAATTTTGTATATTAAATACTAAAAACGTCGTATCTTTAAAAAAAAAACTGTATA
TAGTCAGGTTGAAAAATCTACCAAATAACAAAAAAATGTATCCTTAGAAACCCCGTGTATTACTCGTGTTGAATAAATCTAATTTTACATAGCAAATAATAAAAAAAATTATATCTTTAA
AAACTTCATGTATTACACGTGTTATATAAATGTAACTTTGCATAGTAAATAATAAAAAAAGTTATATTTTTAAAAACCCCGCGTTGTACACGAGTTGAATAAATATAATTTTGTATACCA
GTTAATAAAAAAAGTTATATTTTTTAATAAATTAGGATAATATTTAATATTAATTTATTATTTATATATTTAATATAAGATAAGTAGGAAAGAGATGTATTTATTTTAAAAATATATTAA
ATGATTTAGATTTGACGATAATATTTTATTAAAGTATGATAAGATTTAATATTAATTTATTATTTATTTATTTAGTTAATATAAGATAAATATAGATTTGAGGATACCTTCTATAAATAA
CACGTGTCCAAAACTTGGTTTCTTTTATTATAGTAGATAGATTACTTGCCTTTTGAATAAACGATTAAAGAGTTTTTCCACAAAAAGTAGCAATAATTAGTACTAGAAACAAGTTTTTTT
TAGATTTAAAAAAGAGTTAATTACATAGTTAGTCCCTGTGGTTTCCACAAAGTAACATACTTAGGTATTAATAGTTTAAAATCACATTCTAGGGTATTAACTTTTCATTATGTAACGTTT
GGAGGTATTAACGCTATTTGTAGGTTTAAAATCACATTCTATTAGTACCTAAGTATGTTATTTTGTGCAAACCACAGGGACTACCTATGTTAATACCCTAGAAGTTAATACCTCCAAACG
TTACAAAATGAAAAGTTAATACCCTAGAAGGTGATTTTAAACTATTAGTACCTAAGTATGTTATTTTGTGCAAACCACAGGGACTAACTATGTAATTAACTCTTTAAAAAACCAGAAATT
TAGGAGAACACTCATTTTTTATATATTATATAACAAATTACATGAAATTACTTTATTTATCTATTTGTGTATCATTGAAATGCCTTAGTTACCTAACCAACGCAAAAAAATACCATTTAC
TGATATCGTTAGTTAGTAGGTGTTGGTGGATTTTAACAAACTTATGTTTAATATTAGAGTAAATTACTGTTTTGACTCTTTTGGGTTATTCAGTTTAACTCTATCAGCCTAAAAGGAAAT
CTTTTAACATATTAGACCCTGAGTTTGTATTTTATAACGATTTTGGCATCTAACACTAACTTTGTTATTTTTTGCAGTTAAGTGTAAGTGTAATTAGCTCATTATATACCTTAGGGGTTG
TTTTTGATAATTACAAAGTTCTTTTAATATTTAATATACTATTAATGCAATTACTCAAGTTAATTTTATTATTTTGTCATTTTCACGATTATTATTTAACAAAATACGTTTTAAATATAC
AAATAAATATGTATTTTCTTTAACCATTTAACATCGTTTTTAAAATTATTTGTTTTTTAACCTTTTTTTAAACTGTCTATCGTTTTTAAAATTGTTCTTTTTAGACCATTTGTGTTTTTA
AATCGTTATTTAAATTCGTTTGTCTTTTGAAGTTTTTTTAAACAGTTCATTATACCATTTTTTAAATAATTTTTTTAAAACTTTTTTAAAAAATTTATTTTTTAAGTCGTTCATTTTTCA
AACTTTATAAAAAACAAAAGATTGTTCATTTTTCAAAGTTTTTTTAGAATGATTTATCTTTTTTCAAATCTTTCATTTCTTTCGTTCGTTTGTTTGTTCAAAATTCGTTATATTTTAACC
TTTCGTTTATTAATTCGTACGTTTTTTAGAACCTTACACTTGTTAACTTATTTTTTAAGGTTTTGTTTTTTTAAAACGTTGTTTTTAAAATCTTCGTTTTTAAACCACTCATTCGTTTAA
AATTCACCGTTTTGAAATTACTTCGGATTTTTTGGACATTTTTTTTACCTAACGGCTATAAGTAAATTGAATACAAAGTTTGGAGCGCTATTAAAAATGTTTTTAAAAGAAACAATTTAA
AAAGAAAAGCTTTTAAAAATGAACGACTTAAAAAAGCGAAGTGTTTAAAAATAAAATAAAAACGATTAAAAAAGGTATAAAATGAGCTGTTTGTAAAAACTTTACAGGACAAAAGACTTT
AAAAAGAACTATTAAAAATGAACAATTTTAAAAAACGTTGACGGTCAGAAAATGTTTAAAAACAAATGATTTTGAAAATGGCGTTTATAAAAAACAAACGGTTAATAAAAATACATATTT
ATTTGTATATTTAAAAACGTATTTGGTTAAATAATAATCGTGAAAATAACGAAATAATAACAAAAAACTTGAGTAATTACATTAATTAATAGTATTTCAAATATTAAAAGAAACTTTGTA
ATTATCAAAAACAACTCATAAGATATAATGATCAAATTACCCTTATACTTAGTTGCAAAAAAAGTAACAAAGTTAGTGTCAGGGGTTAAAACTATTATAAAATGTAGCCTCAAGGTCTCA
TAGTAAAAATATTTCTTTTTGTGTTGAAATGGTTAATTGGCTAAACCACAGGCTCAAAACAGTAATTTACTCTTAATATCTTCCTATTCTAATAGCTAAAAAACTTTTTTGGACACGTAT
CGCTTTCTGATGCTTTCTCAAATTATTTTCCTATTTATTTCTCATAGTAAATATTAAATAATAATAATTATTATAAACAAAATATTAGATAATGATAAATATTAGTATACGAGTTTTTTT
AAAGATATATATCTTTTTTATTATTTATTATATAAAATTACATTTATGTAAAATAAAAAAAAAACGATGTAAAATATTATAACAAGTAAATAGTACATCAATGTTTATTTTGAAAAGATA
AATCTTGATGACTATTTGTGTTAACATATAACATTATATTTTTTATTTAACACGTGCAATATACGAGTTTTTTTAAGATATATCTTCTTTACTATGTATTATATAAAATTACATTTGTGT
AATACACTACTTCTAACCTCGTTAAGTAATATTTGTTGATAAAATTTAAATTGTTTGATTTGGTACAGCAACGCCCTTCGAGTGCTTACAATACCCCTTTCTGGACTACAAATGCCGGTG
CACCCGTTTACAACAATACTGCATCATTGACTGTGGGCAATAGAG
GTACTTACTTTGATTTCATGCTTCATTCCTTCCTTATGATCGCTAATCTTGTAAGTACTGACAGGTCCAATTCTC
CTGGAGGACTATCATTTGATCGAGAAACTAGCCAACTTCACTCGTGAAAGGATCCCAGAACGTATTGTGCATGCAAGAGGTGCGAGTGCAAAGGGGTTCTTCGAGGTCACTCATGACATC
ACCCATCTCACCTGTGCAGATTTCCTTCGTGCTCCTGGAGTTCAGACTCCGGTTATCGTTCGATTCTCAACCGTTATCCATGAACGAGGAAGCCCTGAAACCATCAGAGACCCCAGAGGT
TTTGCAACAAAGTTTTATACCAGAGAG
GTACGTGTTGGATCAGTTCTGTTTTAAACATAATGGAAAACATGAATAATACCTGTTACAGCAGACAGGCCAGCAGAGAATCCAGTCAGAGAT
GCAGCCATTGAGTTCGACATGATTGTCAGGATGATCTGGTTCCTCTTTGGGGTGTAAGTTATGATGGTGATGAAACCGAAATAGGGAGGTTTCGGTTTTAGGGAGAGAGTATGCGAAATT
GATGTTAATGAGGGTTTGTGATTGTGTAATGTGTGTAACCCTTTAACTCTCTAATAAGCCCCTTATTTATACACCCAAGAGGAAACCCAATTAGTTAATAAGGGTAATATGGTCCATCAA
CAATTACCAACTAATTATTAATAGGTTATTAAATATATTTTGATCTAATATAATATAAATGATTATATAGGCTACAAGATTAAATATTACATTTATATATTTAATCTCACATTCTCCCAC
TTAGCCAAGTAATCATTTATCATGAGTATTAGGTAAGCCTGGCCAGGAGTTAACACTCATTTTAGCTTTAAACCAAGAACTATAGCAGAGAAATACAGCCGTTGAATCATCATTCGACTC
AGGACCCCCATTAGTCATACTATAGCCTCAATTTAAAACCTAACAGTTACGATCAAAATATGTATAAGCCCTTTAGCGTCTGATTAGTATTTATATTTGTCTATATGTCATTACACCGGC
AGAACATATGTTAGAGACATACAAAATCAAACTGAGGAAATTTTATTAATTAAAACATAAGCTAGTACAATATGCCATTAAACAAGGTCTTTAGTAAGTCCCATATTCGATACATGTTCT
TCGAAAACTTTAGGTGGGAGACCTTTAGTCATCGGATCCGCTAGCATATCTTTAGTACTAATATACTCAATACAAAGATTATTTTCCTCAACACGTTCACGTACGAACAAGTACTTTGTA
TCGAGATATAAACCAGCTCCAGTCGAACTGTTACTGTTCGAGAAACTAACGGCAGCTGAGTTATCACAATAAAGCTTCAATGGTCTAGAAATGGAATTAACAATCTTGAGTCCAGTGATC
AGATTTCTAAGCAACATTCCATGACAGGTTGCGTTGTAAACAGCAATGTATTCTGCCATCATTGTGGAAGTTGTAGTTAACTGTTGTTTATGACTCTTCCATGAGATAGGTCCGCCTGCT
AACATAAAGATGTAGCCCGAAGTGGATTTCTTGTCATCTTTGCATTTGGCAAAGTCAGAATCAGAATAACCTACCACTTCTAAGTGATCACTTCTTCTATAAGTCAGTTTATAGTCTTTC
GTCCCTTGCAGATATCTGAGGACCTTCTTAGCTGCTTTCCAGTGATCTAGGCCAGGATTAGTCTGATAACGGCCTAGCATTCCAGCAATATAAGCGATATCTGGGCGAGTACAGACTTGA
GCATACATCAGGCTCCCGACTACTGACGCGTAAGGTATCTGGCTCATTTGCTCCTTTTCAACCTCTGTTGTCGGACACTGGAATGAACCGAAAACATCTCCCTTAACTACTGGAGCGACG
GAGGGTTTGCACTGTTGCATGTTGTAACGTGTAAGGACACGATCTATGTAAGTCTTTTGAGACAATCCTAAGATCCCTTTGTGTCTATCTCGGTGAATTTCGATGCCAATGACGTAAGAA
GCATCTCCGAGATCCTTCATGTCGAAGTTATGCGAGAGTAACCGCTTCGACTCATGCAACATGTCTAAACTATTACTTGCCAATAGAATGTCATCTACGTAAAGGACAAGTATAGTAAAG
TTACTCCCACTCATCTTGAGGTAGGTGCATTGATCCACTTGATTCTTCATAAAACCTTGCCTCTTCATGACTTCATCAAACTTGAGATACCATTGACGTGATGCTTGTTTTAACCCATAA
ATGGATTTCTTCAACTTACAGACTAGATGCTCCTGACCTTCAGGTTTAAAGCCTTCAGGTTGTTTCATGTAAACATCTTCGTCTAAGTCTCCGTTAAGGAAAGCAGTTTTGACGTCCATC
TGATGCAGCTCTAAATCAAAATGAGCTACTAGGGCCATGACGATCCTTAATGAATCTTTACGAGAGACAGGTGAAAACGTCTCTTGATAATCAATTCCCTCTTTCTGAGTGTAGCCCTTT
GCAACCAATCTCGCTTTATAGCGTTCAACGTTCCCATTCGGATCCAGTTTTGTTTTGAACACCCATTTACAACCTACAGGTTTGACACCGTTGGGTAATTCTACCAAATCCCAAACGTCA
TTTTTCTTCATGGATTCAAGCTCATCAATCATTGCTTTGTTCCATTCAGAAGACTGATCACTGCTAATGGCTTCATTATAAGAGATAGGATCATTGAGCTTTCCAGCATCCATTTCAGTC
AGGTAGGTGATATAATCATCCCAATTAGTAGGCCGTTTTTGCCTAGATGACCTCCTGAGCTGATTTTCGGGTTGAGCGTTGTCTTGGTTTTGAGCGTTTGATGTGCCTTCGTTATGAGGT
ATAATGGGTTCTGGTTGTGGAGTTGGAGTTTGTGCAGTGGCTTCAGGTGCAGTTGCATGTGGTACAAGAGGAGTAAACGGAGTAATGGTAAGCGACGAGTCTCTCCCCCCCGCGTCTTGT
ACTTCTTGCAATTCTTCGTAAGGGTTGGTACTGCTCCCACTGACCTTGAAATCCTCCAGGAACGCAGCACGCTTGGTTTCAACAATACGGGTGACATGGGAAGGACAATAGAAACGATAA
CCCTTTGAATGATCAGGATACCCGATAAAGAAACAGGTAACTGTTTTAGGGTCAAGTTTCCTTAGGAAAGGATTATATAATTTTGCTTCAGCAATGCAGCCCCATACTTTCATATATTTA
AGACTCGGTTTCCTTCCTGTCCAAAGTTCATAAGGAGTTTTAGGGACAGACTTAGAAGGAACTCTATTGAGTATATGAACAGCTGCTTTTAATGCTTCAGTTCAGAGGAATAATGGTAAA
TTAGTGTTGGCTAACATACTGCGCACCATGTTCATAAGGGTACGATTTCTTCGTTCAGCGACACCATTCTGCTGAGGTGTACCAGGCATGGTGTATTGGTTCACAATCCCCTGGCCCTTA
CAAAACTCATAAAATGGACCAGGAGCTTGACCCACATCAGTATGTCTTCCATAATATTCACCGCCTCTGTCTGATCTCACAACTTTAATTTGACGATCTAATTGCTTTTCAACTTCAGCT
TTATAATCTTTAAAAGTTGTAAGAGATTCAGACTTTTCCTTTATAAGATACAAGTACATGTAACGAGAATAATCATCAATGAAAGTGATAAATGAATTATGTCCTGTGATGCCAGCGATT
TGATAGGGACCACTAATGTCAGTGTGAATGAGTTCTAATAAATTAGAGCTCCTAGTGGCACCTTTCTTATTCGCTGATGTCATTTTGCCTTTAAGACATTTGACACATGTTCCAAAATCA
GTGAAATCGAGAGGAGGTAAGACTTCATCCTTTACGAGACGATTTAATCGTTCTCTTGAGATGTGGCCTAAACGTTGATGCCACAACATAGATGAAGTCTCTAAGTCTCGAATTTGTTTC
TTTTCCATCTTTGTGAGTGATTCATTAATATTATATGACAACAAAGATTTGGAAAAATTGTCATCTAGTTCTAATCTATAGAGACCACCATCCAGAATGCCAGTACCATAAACAACGGAA
TCATAGAGAATAGAGAGTTTGCGATGACCATGAGAAACGACAAAACCGTCCATGTCTAACTTTGGTCCTGATACAAGGTTCCGAGTTACCTCAGGAACATATAAGGTATCATAAAGTTTA
ATACATAAACCAGTTTTCAAAAATAATTGTAATGTTCCTATGGCCTTCACTTCTAATTCCCGATCATCCCCAACTTTAAGTGTTCTTTGGTTTCTTCCCAGCTTCCGGATTGTAAGGAAT
CCCTGAAGTGAATTGGTTACATGAACCATAGAACCAGAATCAAACCACCAAGAATTAGCAGGAACATTTAAATTAAAGGACTCAAGTATCATGAAAAAATCGTTACCTTTCTTAGCCAGC
CACTCCTTAAAGTCAGGGCATTCCTTTTGCTTATGTCCTGTTTTCTTACAGAACTTGCAATAGGGTTTGCCTAAGGAGTTCTTAGAGCTGGAAGGTGCACTTGTATTAGGATTTGGATTT
GGCTTTTGAACCTTAGAAGCATCCTTTCTATGATAAGAGTTCTTCCTTTTCTTTGAGCTGGAAGTGGTGAAGTTAGCAACATCAGTAGTGCGATCCATCTTCATACGCTCTTCCTCCTGC
ACGCACATAGCGATCAGCTCACTCATCGTCCATTTGTCCTTCTGAGTGTTGTAATTGATCTTAAAAGCTTCATAGGACGAAGGAAGCGAAGTGATGATGAAGTGAACGAGAAAACCATCA
CTGATTTCCATCTCTAGGCCCTTCAGCTTATTGGCCATATCATGCATCATCATGATGTGTTCGCGAATGCCGCTCCTCCCATCGTACTTAGTTGTCACCAGCTTGAGGATAAGAGTGCTA
GCGTGTGCTTTTGATGTTCCCTTGAATTGATCCTCCACAGAAGCCAGATAGGTTTTAGCATTTTCAGAATCAGGAATGGCCCCTCTGATTGAGTTATGAATGGATTGCTTCATGAACATG
AGAGACATGCGGTTACACCTAGTCCATTTATCATGGACTATCTGCTCAGCAGCAGTACTGGTGGCGGTAAGGTCCGCTGGCTTATTCTCTCTTAGAGCATAGTCAAAGTCTAGCAATCCT
AGAGTAAGCATGAGGGCATCCTTCCATTCAGCAAAGTTATCACCAGTCAAAGGTGGAATCCCGCAATTGGGTGCTGTTAGTGGAAATAAGATGAGCAAGTTATGATACAAAAGAAGAAAA
CCTAATGTGATCTAATGGGCTTGTTACACTAAGGCAGGCATAAATAATGACCATTATAATTATGAAGCTGTGATAATGTCCATTACTAACATCAAAATAATAGACTTAGTAAAAATTCTA
CTTAAACAAAGACAAATCAGCTTTGGCCAGAAGTGTAATCATTTAAGTATGTGTGCAAAGCAATCGTGACAAATCAGCTTTGGCCAGAAATGAGACAATCACTTTAGTTATGCACTTGTC
AAGCATGCTAAACATAAATGAATTAAATCAGCTTTGGCCAGAATTAAGACATTTCAGGTTTGTAATGCATACTTAACATAGCCTTTTATAATACTTGAACAATAAATAGATGTATTAAAT
CAGCTTTGGCCAGAATTAATACATCAGAAGCTCATCCAAGTTAAGCTATTTTGGTTTTGTAAAAAGTTATCTGATTCTGATTAATGAATTAAGTATTGACAAAACCAAGTATTTAATAGC
AAACCACCTGTTAGCGCGGATCGAGTCATGGTCTCGAGTCGCAACCTTAGTCTCGAGTCGCAATCTTAGTCTCGAGTTGTGCTGTTATGGTTTCGAGTCGCAACCTTAGTCTCGACTAAT
CACGTTATGGTTGCGAGTCGCAACCTTAGTTTCGACTAATCACGTTATGGTTGCGAGTCGCAACCTTAGTTTCGACTAATCACGTTATGGTTGCGAGTCGCAACCTTAGTTTCGACTAAT
CACGTTATGGTTGCGAGTCGCAATCTCATGGTTGCGAGTCGCAACCTTATGGTTGCGAGTAGCAACCTCATGGTTGCGAGTAGCAACCTCGTTAACAGCTGTTTTGTGATAATAACTGAA
AACTCGAAATTTAAGGGATTGTGGGATAATGTTTCCTGTTTTAATGCTGATCTAAACTTATCAAAATATTTCGAAAATAATAACTGATATCTCTTTAACAGTTTTCGGAATTTTATTAGA
TAAAAATAAGATCAAAAACAGGAAAAACACCCACTAATCTAAATTATATTCCAAATCTTAGGGAATTTTCGAGTTTTCTTAGAACATTATGATGAACCCTAACAAAATAAGAACATAATC
TGGAAATCCGAAACCTGATTTTAATGGTTTTGTAAGGGATTTCGTGATAATAAGTTTAATCTTTATAATTTCGAGTCGGTTTATCAATTAACAGTTTCCGAAAACAGGGATTTCGGTCAC
AAACAACCCGAAAACAGTTTTTTGATTTTAAGGCTTTAAAAACTTCCGTTTTCCAGATTTTGATCCAAGAATAATGGATACGAAAACAGAACTGGTTTATCAACATATGCTCTGATACCA
CATGTTGGATCAGTTCTGTTTTAAACATAATGGAAAACATGAATAATACCTGTTACAGCAGACAGGCCAGCAGAGAATCCAGTCAGAGATGCAGCCATTGAGTTCGACATGATTGTCAGG
ATGATCTGGTTCCTCTTTGGGGTGTAAGTTATGATGGTGATGAAACCGAAATAGGGAGGTTTCGGTTTTAGGGAGAGAGTATGCGAAATTGATGTTAATGAGGGTTTGTGATTGTGTAAT
GTGTGTAACCCTTTAACTCTCTAATAAGCCCCTTATTTATACACCCAAGAGGAAACCCAATTAGTTAATAAGGGTAATATGGTCCATCAACAATTACCAACTAATTATTAATAGGTTATT
AAATATATTTTGATCTAATATAATATAAATGATTATATAGGCTACAAGATTAAATATTACATTTATATATTTAATCTCACAGTACGTCAATTGTGAGATCCAACTAACAAACCTAGTAAT
AATATAATTCTAGGTTAGGTTAGAAACCCGTGTATGGTAGAGTTCAAATACATGAAATATTAGTAGTAACGATTTAGAAATTATTAGAGATAGTAGGAATTATACAACAATATTTTGAAA
TAATACATATTTACAAAAATAAGAGATGGAATACAATGCAGTGAAATAAGAGAAGTCGGAAAAAGAATCTTGGTCTCCACTATTATTAACAGCGAGCATAGCGCTTGCTATAGAGTTTAG
CGTGGCAATGCAGCAATAAGTTGCAATATGATTTTGGCGCTTCCATAGCATGGAAATAGCGGGATTATAGTTTTTTTAAACTTTAATCAAATTAGTGCTAAAATATACTAATAAAATAGT
ACGTGGGATTTTAGTTTTTAAAAATATACATATAAAAAACATAAAAACATAGTATTTTGATAAAATAAACATATATCGTATTTCTAAAATTTTCTTTTAATCTATCGCTAAACATTTCAT
ACTATCATAGTGCCCACTATGTTATCTATATCGCTACACAACATATAAGTAGCTTGTCGCTAGTGTCTGCTATTCGCCATTAACAACTATGTTGGTCTAGTAGAATTGTGACATTTGTGC
AACTAGTTATTTGTTTATTAAGTATAGATAGTAAACCAGACAACATAGAATATGGCTAAAAGAATCAAAGCAACAAGTTGTAAACTAGTGCTAGCATAACGTAGTGAGATCTATGATTGT
TTGATTTTCTTGAAGTTTTTGGTGTTTAGATTTGGTGATTCAAATGTGTTCAACTTGCAGGGTAACTTTGATATTGTGGGGAACAACTTCCCCGTGTTCTTTACTCGCGACGCAATGGCA
TTCCCGGATGTGATTCATGCTTTCAAACCAAACCCCAAGTCACACATCCAAGAAGACTGGAGGATCCTCGACTTCTTGTCACACCATCCTGAGAGCTTGAACACTATGACATTCTGGCTC
GATGACGTCGGTATCCCAACCGATTACAGGCACATGGAAGGGTCAAGTGTCAACACCCTCACTTTAGTTAACAAAGAAGGTAAAATGCACTATGTGAAGTTCACATGGAAGCCCACATGT
GGAGTCAAGTGTTTGATGGATGATGAAGCTATCAAAATCGGAGGAGCTAATCACAGTCACGCCACTCAAGATCTTTACGATTCGATTCAAGCCGGTAACTTCCCTGAATGGAAGCTGTTT
CTTCAAGTTATTGACCCGGATCATGAAGACAGGCTTGACTTTGACCCGCTCGATGGCACCATGACCTGGCCTGAGGATGTCATACCGCTGCAGCCTGTCGGGCGTATGGTGTTGAATAAG
AATATTGATAACTTCTTTGCTGAGAATGAACAGCTGGCGTTCAACCCGGGTCTTGTTGTCCCGGGAATTTATTATTCTGATGATAAGATGCTTCAAGGTCGGATCTTCGCGTATTCTGAT
ACGCAGAGGCACCGTCTTGGACCGAACTATTTGCAGCTTCCGGTTAATGCGCCTAAATGCGCTCATCATAATAATCACTATGATGGACATATGAATTTTATGCACAGAGATGAGGAG
GTA
CACCTTTTTTGTATATTTGTTTTAATTTATTAGAATTTGTGGTTCTTTTATTTACCGGAATTAATATTTTCTTTCAGGTTGATTACTTCCCTTCGAGGTATGATCGTGTTCAACATGCTC
AGAAATACCCGATCAATCCGGCTAGGGTTACTGGAACCCGTGACAGG
GTGAGTTTCTTGTCTCATTGGATCCATTTTTTTAGTTTCATAGAATATGTTTACAAAATCTACATTATTATAA
AAATAACCTTAACTTTCTTTATTAAAGTAATTTGGAGGCTGTTATGCATTTGAATACAACTCGATGATTTCTAAATATTTCGACACGTTAAATTTTTAATCCTTTTTCAATATGTATTAA
CATCAAAGTAATTAAATGAGCATGTTGTTTTGTGAATGCAGACTGTGATCCCAAAATATAACGATTTCAAGCAGCCAGGGGAGAGATACAGATCATGGGATCCAGCCAGGTACATGTTGT
ATCTCGTTATTTATAACGGTTTTGAGATTCCCTTGATTGTCTAAGCTGTTGATGTTTATTCTATAGGCAAGAAAGATTCATTGTCCGAATGTGTAAGATGTTGTCCGACCCACGGGTTAC
CCACGAACTTCGCAGTATTTGGATCTCATATTGGACCCAAGCTGACAAGTCTCTGGGGCAGAAGATAGCATCACGTCTCAATGTGCGCCCCAACTACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCCTACAAGCAACGCCCTTCGAGTGCTTACAATACCCCTTTCTGGACTACAAATGCCGGTGCACCCGTTTACAACAATACTGCATCATTGACTGTGGGCAATAGAGGTCCAATT
CTCCTGGAGGACTATCATTTGATCGAGAAACTAGCCAACTTCACTCGTGAAAGGATCCCAGAACGTATTGTGCATGCAAGAGGTGCGAGTGCAAAGGGGTTCTTCGAGGTCACTCATGAC
ATCACCCATCTCACCTGTGCAGATTTCCTTCGTGCTCCTGGAGTTCAGACTCCGGTTATCGTTCGATTCTCAACCGTTATCCATGAACGAGGAAGCCCTGAAACCATCAGAGACCCCAGA
GGTTTTGCAACAAAGTTTTATACCAGAGAG
GGTAACTTTGATATTGTGGGGAACAACTTCCCCGTGTTCTTTACTCGCGACGCAATGGCATTCCCGGATGTGATTCATGCTTTCAAACCA
AACCCCAAGTCACACATCCAAGAAGACTGGAGGATCCTCGACTTCTTGTCACACCATCCTGAGAGCTTGAACACTATGACATTCTGGCTCGATGACGTCGGTATCCCAACCGATTACAGG
CACATGGAAGGGTCAAGTGTCAACACCCTCACTTTAGTTAACAAAGAAGGTAAAATGCACTATGTGAAGTTCACATGGAAGCCCACATGTGGAGTCAAGTGTTTGATGGATGATGAAGCT
ATCAAAATCGGAGGAGCTAATCACAGTCACGCCACTCAAGATCTTTACGATTCGATTCAAGCCGGTAACTTCCCTGAATGGAAGCTGTTTCTTCAAGTTATTGACCCGGATCATGAAGAC
AGGCTTGACTTTGACCCGCTCGATGGCACCATGACCTGGCCTGAGGATGTCATACCGCTGCAGCCTGTCGGGCGTATGGTGTTGAATAAGAATATTGATAACTTCTTTGCTGAGAATGAA
CAGCTGGCGTTCAACCCGGGTCTTGTTGTCCCGGGAATTTATTATTCTGATGATAAGATGCTTCAAGGTCGGATCTTCGCGTATTCTGATACGCAGAGGCACCGTCTTGGACCGAACTAT
TTGCAGCTTCCGGTTAATGCGCCTAAATGCGCTCATCATAATAATCACTATGATGGACATATGAATTTTATGCACAGAGATGAGGAG
GTTGATTACTTCCCTTCGAGGTATGATCGTGTT
CAACATGCTCAGAAATACCCGATCAATCCGGCTAGGGTTACTGGAACCCGTGACAGG
ACTGTGATCCCAAAATATAACGATTTCAAGCAGCCAGGGGAGAGATACAGATCATGGGATCCA
GCCAG
GCAAGAAAGATTCATTGTCCGAATGTGTAAGATGTTGTCCGACCCACGGGTTACCCACGAACTTCGCAGTATTTGGATCTCATATTGGACCCAAGCTGACAAGTCTCTGGGGCAG
AAGATAGCATCACGTCTCAATGTGCGCCCCAACTACTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTATAAATAG TCACAAGCAT TAGCAGTGAA GAGCCGTACA AGTTGATCAC AAGCAACTAG CTTCTCTCTT CTTTCTTACC TTGCGATCAT CAATACCATG GATCCCTACA AGCAACGCCC  TTCGAGTGCT TACAATACCC CTTTCTGGAC TACAAATGCC GGTGCACCCG TTTACAACAA TACTGCATCA TTGACTGTGG GCAATAGAGG TCCAATTCTC CTGGAGGACT ATCATTTGAT  CGAGAAACTA GCCAACTTCA CTCGTGAAAG GATCCCAGAA CGTATTGTGC ATGCAAGAGG TGCGAGTGCA AAGGGGTTCT TCGAGGTCAC TCATGACATC ACCCATCTCA CCTGTGCAGA  TTTCCTTCGT GCTCCTGGAG TTCAGACTCC GGTTATCGTT CGATTCTCAA CCGTTATCCA TGAACGAGGA AGCCCTGAAA CCATCAGAGA CCCCAGAGGT TTTGCAACAA AGTTTTATAC  CAGAGAGGGT AACTTTGATA TTGTGGGGAA CAACTTCCCC GTGTTCTTTA CTCGCGACGC AATGGCATTC CCGGATGTGA TTCATGCTTT CAAACCAAAC CCCAAGTCAC ACATCCAAGA  AGACTGGAGG ATCCTCGACT TCTTGTCACA CCATCCTGAG AGCTTGAACA CTATGACATT CTGGCTCGAT GACGTCGGTA TCCCAACCGA TTACAGGCAC ATGGAAGGGT CAAGTGTCAA  CACCCTCACT TTAGTTAACA AAGAAGGTAA AATGCACTAT GTGAAGTTCA CATGGAAGCC CACATGTGGA GTCAAGTGTT TGATGGATGA TGAAGCTATC AAAATCGGAG GAGCTAATCA  CAGTCACGCC ACTCAAGATC TTTACGATTC GATTCAAGCC GGTAACTTCC CTGAATGGAA GCTGTTTCTT CAAGTTATTG ACCCGGATCA TGAAGACAGG CTTGACTTTG ACCCGCTCGA  TGGCACCATG ACCTGGCCTG AGGATGTCAT ACCGCTGCAG CCTGTCGGGC GTATGGTGTT GAATAAGAAT ATTGATAACT TCTTTGCTGA GAATGAACAG CTGGCGTTCA ACCCGGGTCT  TGTTGTCCCG GGAATTTATT ATTCTGATGA TAAGATGCTT CAAGGTCGGA TCTTCGCGTA TTCTGATACG CAGAGGCACC GTCTTGGACC GAACTATTTG CAGCTTCCGG TTAATGCGCC  TAAATGCGCT CATCATAATA ATCACTATGA TGGACATATG AATTTTATGC ACAGAGATGA GGAGGTTGAT TACTTCCCTT CGAGGTATGA TCGTGTTCAA CATGCTCAGA AATACCCGAT  CAATCCGGCT AGGGTTACTG GAACCCGTGA CAGGACTGTG ATCCCAAAAT ATAACGATTT CAAGCAGCCA GGGGAGAGAT ACAGATCATG GGATCCAGCC AGGCAAGAAA GATTCATTGT  CCGAATGTGT AAGATGTTGT CCGACCCACG GGTTACCCAC GAACTTCGCA GTATTTGGAT CTCATATTGG ACCCAAGCTG ACAAGTCTCT GGGGCAGAAG ATAGCATCAC GTCTCAATGT  GCGCCCCAAC TACTGAACTA GTATCTTAAC GAGGGCCTGA TAGATACGGT CCGTCTCTAA GTTGGTTATG TCACACAAAT GGTGTCTATG TTTCCGTTCT ACCTTTCCTT CTGTTGTATT  TTCACGCGCT TAAGGAACCT GAAACTTAGT CGATATGTGG AGTGAGTTAC TGTGTTTCAG GTTCGGGTCT ATAAAGAGAA AGTCTAAGCT TTGTGGCACA CATGTTATGT TTCTTTTTTA  AAATAAAATG TAATGTTGTT TTGGCCACTT ATTTGATTCT TATGTGTGAG TTTGCCGTTC TAAAATATAT ATTAATAAAA AGTAAAATTT GATGCTTATG TTCATGTATT TCTCTCGTAA 
AATTTGAGCC CACTTGTGAG ACATGATCCA CTAG 

Retrieve as FASTA