Entry information : SmRboh03-2_66 (SmRboh03b_66)
Entry ID 7384
Creation 0000-00-00 (Christophe Dunand)
Last sequence changes 2010-06-01 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmRboh03-2_66 (SmRboh03b_66)
Name (synonym) SmRboh03-2_66 (SmRboh03b_66)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmRboh03-2_66
start..stop
S start..stop
SmRboh03-1_13 1400 0 87..796 1..693
SmRboh02-2_137 1031 0 29..796 125..902
SmRboh02-1_19 1030 0 29..796 118..895
SmRboh04-1_39 1025 0 16..796 1..788
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 411434..411689 256 N° 2 411744..411906 163 N° 3 411954..412002 49 N° 4 412076..412189 114
N° 5 412238..412645 408 N° 6 412707..413093 387 N° 7 413142..413237 96 N° 8 413287..413402 116
N° 9 413468..413596 129 N° 10 413722..413927 206 N° 11 413956..414104 149 N° 12 414223..414351 129
N° 13 414414..414492 79 N° 14 414551..414660 110  
join(411434..411689,411744..411906,411954..412002,412076..412189,412238..412645, 412707..413093,413142..413237,413287..413402,413468..413596,413722..413927,41395 6..414104,414223..414351,414414..414492,414551..414660)


exon

Literature and cross-references SmRboh03-2_66 (SmRboh03b_66)
DNA ref. Phytozome 11:   scaffold_66 (411434..414660)
Protein sequence: SmRboh03-2_66 (SmRboh03b_66)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   796
PWM (Da):   %s   90859.88 Transmb domain:   %s   o245-267i331-350o385-407i428-450o460-477i595-612o
PI (pH):   %s   9.32
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MELKKVGRNGSSARILPLNFSPDGEGGQLSRSMSGTEYAIEGLRFIEKTIASKNAKSQWEAVELRFHKLANEECRLSRSDFGECIGMSDSKEFAELLFDALARRKGHDELWTASKEELRDFWLQITDKRFSSRLQTFFDLCDTDLDGRISENEVKIILLSASANKLSFLQEQAEEYAALIMGELDQNKQGYIEVKQLERLMREPIALAEDPSYGYACAPTLHSRRRNRLHLLQRTIKYFALDNWQRIWVLCVWFLAMTGLFTWKFIEYKNRAAFKIMGYCVCTAKGAAETLKLNMALVLLPVCRITITSLRSTVFGSILPFNDNINFHKLIAAAILFGVLLHGGTHIACDFPKMANANSRIFLDTIGHGFHGRQPSFLGILASIEGITGIIMVVLMSIAFLLATHWSRKNIVRLPWPLHRLTGFNAFWYSHHLFILVYALLIIHSVFLFLTPDWLQKTTWIYLSCPLLLYVGERFLRVLRSRQHRVNIVKAAIHPGNVLALDMTKPPGFKYRSGMYMFLQCPAISPFEWHPFSITSAPDDEFLNVHIRTVGDWTKEMRKMFAKVCLLPLQCLFPKLYIDGPYGAPAQDYRKYDVMLLVGLGIGATPFISILKDMLNNIKSTEQQSVSFSLLFSSSFLSTYFSKPFDSPRRKSRKSRGPTNAYFYWVTREQGSFEWFKGVMNEVAEIDHKAVIEMHNYLTSVYEEGDARSALIAMVQALHHTKNGVDIVSGTRARTHFARPNWDKVFARLTATHDNSRGVFYCGPSQVAKELDVLSRKYSQESNTKFIFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (13 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCTCAAGAAGGTGGGGCGCAATGGGAGCTCCGCGCGGATCTTGCCGCTGAATTTCTCCCCGGATGGCGAGGGCGGCCAGCTCTCGAGATCGATGTCCGGCACGGAGTATGCGATC
GAGGGCTTGCGCTTCATCGAGAAGACAATTGCCAGCAAGAACGCAAAGTCTCAGTGGGAGGCTGTGGAGCTTAGATTTCACAAGCTCGCCAACGAGGAGTGTCGGCTTTCACGCTCGGAC
TTTGGGGAATGCATTG
GTAAGCCAACAAGAAAGAGTTTGATGGAAAAGCTGACGATCGTTAACTACTCAGGAATGAGCGATTCCAAGGAATTTGCGGAGTTGCTGTTTGATGCTCTAGCC
CGGCGGAAAGGCCATGACGAGCTGTGGACCGCTTCGAAGGAAGAACTCCGGGACTTTTGGCTTCAAATCACAGACAAGAGATTTAGCTCTCGATTGCAAACATTTTTTGACTT
GTAAGTT
GTCCAGTCTTTTCTTTGATTGTTCTAAATTTTATCCATAGGTGTGACACGGATCTGGACGGTCGCATATCAGAAAACGAAGTGAAAGAGGTACATATGGAGTTGATTTTACTCCCTCTGC
TTTTGCTCGAGCTAAACTAAAGGAACAAGCCCCGGATTGCAGATAATTCTACTCAGTGCGTCGGCGAACAAGCTCTCGTTTCTGCAAGAGCAAGCTGAAGAATACGCAGCTCTCATCATG
GGAGAACTCGATCAGAATAAACAAGGATACATTGAG
GTAAGAAGCTTCCTACCACGCAACCTTTCAACGTTCAACTTATTTCAGGTGAAACAACTTGAACGGTTGATGCGAGAGCCGATC
GCACTCGCTGAGGATCCGTCCTATGGGTACGCGTGTGCTCCAACTTTACACTCTCGAAGAAGAAACCGATTGCATTTACTCCAGAGAACGATCAAGTACTTCGCTCTGGACAACTGGCAG
CGGATATGGGTGCTGTGCGTGTGGTTTCTCGCCATGACCGGTCTTTTCACCTGGAAGTTCATAGAGTACAAGAACAGAGCCGCTTTTAAGATCATGGGATACTGTGTGTGCACGGCCAAG
GGCGCTGCGGAGACTTTGAAACTCAACATGGCATTGGTCCTGCTGCCAGTTTGCAGGATCACAATCACGTCCTTACGCTCCACTGTTTTCGGATCCATACTACCTTTCAACGACAACATC
AACTTTCACAAG
GTATGACTTCGTTTGTTCCTGTGTTTGTACGCATGCTTACTTACGATGGCCTGTTTTCCAGCTTATTGCTGCAGCGATTTTGTTCGGCGTTTTGCTTCACGGAGGAAC
TCATATTGCTTGTGACTTCCCCAAGATGGCCAACGCAAACAGTCGTATATTTCTTGATACTATTGGGCATGGTTTCCACGGCCGGCAACCATCTTTCCTTGGCATATTGGCTTCGATTGA
GGGGATTACGGGGATTATCATGGTGGTCCTGATGTCAATAGCTTTTCTTCTTGCAACGCACTGGTCCCGCAAGAACATCGTCAGGCTCCCTTGGCCCCTCCACAGGTTAACAGGATTCAA
CGCATTTTGGTACTCGCATCATCTTTTTATTTTGGTCTACGCCTTGCTGATCATACACTCGGTGTTTCTCTTCCTGACCCCAGACTGGCTGCAAAAGACG
GTACCTACATTATGATCTGA
TTGACTTCTGATATTTTTTGTACTGCAGACGTGGATATATCTATCCTGTCCATTGCTGCTGTACGTTGGCGAGAGGTTCCTGCGCGTTTTAAGATCGAGGCAGCATCGAGTCAACATAGT
AAAG
GTAACTTTCCGCAGCAAATTGTCTCTCGCGCTGAAACTTTGTTTCACAGGCAGCAATTCATCCTGGCAACGTTCTTGCCTTGGACATGACGAAACCTCCAGGCTTCAAGTATCGGA
GTGGCATGTACATGTTTCTGCAGTGTCCAGCGATCTCGCCATTCGAGTG
GTAAAAATCTTTGTGACCCTAGCAAGCAGATTGAAACACTTTTTCTTCTTCTTTTGTATGGCCAGGCATCC
CTTCTCGATCACGTCTGCGCCCGACGACGAGTTTTTAAATGTGCACATACGGACAGTGGGGGACTGGACCAAGGAAATGAGGAAAATGTTTGCAAAGGTTTGTTTGCTTCCCCTTCAATG
CCT
GTCCTGATCCACAGTTGTGCGTAGGCAGTTGACACTAGCTCTTCCATCGACGATTCACGGTCAGTGATTCCAACAACCAAACGTTTCCGTTAGTCCGCGGCTGGCTGGCTTACATCT
CCTGACAGGTTTCCAAAGCTCTACATTGATGGACCTTATGGCGCTCCTGCTCAGGACTACCGGAAGTATGACGTGATGCTCCTCGTTGGCTTGGGAATCGGAGCTACACCTTTTATCAGC
ATCTTAAAGGACATGCTCAACAACATCAAATCCACGGAGCAACAGTCGGTAAGCTTCTCTCTTTTGTTTTCTAGTTCTTTTCTTAGCACAAGTT
GTGTTGCTTGCTTGCTCGCAGGACAT
AGACTTTAGCAAGCCGTTTGATAGCCCGAGAAGAAAGAGCCGCAAGTCTCGTGGCCCAACAAACGCCTACTTCTACTGGGTCACCAGAGAGCAAGGCTCGTTCGAGTGGTTCAAAGGCGT
CATGAATGAGGTGGCCGAAATAGATCACAAG
GTCAGCCACTCGTCACCAATCTTAAGTCAGCCCCGCAACCACGATAGAAGCTCTTGGTTGATTGCAATGCTCAAAAGAAAAGATTTATT
GCTGACGTATAAAGTTTTTGCTTCCGCAGGCAGTAATTGAGATGCACAACTACCTCACAAGCGTGTACGAGGAAGGTGACGCGCGCTCGGCTCTCATTGCAATGGTACAAGCTCTACACC
ACACCAAAAACGGCGTGGATATCGTCTCGGGCACCCGG
GTAAAAAACTTTCATCCCCAGAGCTTTCGCTAAGATCTTCTTTTCTTCTTCTTTGTGCCCAGGCACGCACTCACTTCGCAAG
GCCAAACTGGGACAAGGTGTTTGCACGTCTCACTGCTACACACGACAATTCAAGGATAG
GTAAGAAGAAGAGAAGAAAATGATGAGAGCAAACTCCACTTACTTTGGTTGTTGTTAGGAG
TGTTCTACTGCGGGCCTTCGCAAGTCGCCAAAGAGTTAGATGTGCTGTCCCGGAAGTATTCCCAAGAGTCCAACACCAAATTTATATTCCATAAGGAGAACTTTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCTCAAGAAGGTGGGGCGCAATGGGAGCTCCGCGCGGATCTTGCCGCTGAATTTCTCCCCGGATGGCGAGGGCGGCCAGCTCTCGAGATCGATGTCCGGCACGGAGTATGCGATC
GAGGGCTTGCGCTTCATCGAGAAGACAATTGCCAGCAAGAACGCAAAGTCTCAGTGGGAGGCTGTGGAGCTTAGATTTCACAAGCTCGCCAACGAGGAGTGTCGGCTTTCACGCTCGGAC
TTTGGGGAATGCATTG
GAATGAGCGATTCCAAGGAATTTGCGGAGTTGCTGTTTGATGCTCTAGCCCGGCGGAAAGGCCATGACGAGCTGTGGACCGCTTCGAAGGAAGAACTCCGGGAC
TTTTGGCTTCAAATCACAGACAAGAGATTTAGCTCTCGATTGCAAACATTTTTTGACTT
GTGTGACACGGATCTGGACGGTCGCATATCAGAAAACGAAGTGAAAGAGATAATTCTACTC
AGTGCGTCGGCGAACAAGCTCTCGTTTCTGCAAGAGCAAGCTGAAGAATACGCAGCTCTCATCATGGGAGAACTCGATCAGAATAAACAAGGATACATTGAG
GTGAAACAACTTGAACGG
TTGATGCGAGAGCCGATCGCACTCGCTGAGGATCCGTCCTATGGGTACGCGTGTGCTCCAACTTTACACTCTCGAAGAAGAAACCGATTGCATTTACTCCAGAGAACGATCAAGTACTTC
GCTCTGGACAACTGGCAGCGGATATGGGTGCTGTGCGTGTGGTTTCTCGCCATGACCGGTCTTTTCACCTGGAAGTTCATAGAGTACAAGAACAGAGCCGCTTTTAAGATCATGGGATAC
TGTGTGTGCACGGCCAAGGGCGCTGCGGAGACTTTGAAACTCAACATGGCATTGGTCCTGCTGCCAGTTTGCAGGATCACAATCACGTCCTTACGCTCCACTGTTTTCGGATCCATACTA
CCTTTCAACGACAACATCAACTTTCACAAG
CTTATTGCTGCAGCGATTTTGTTCGGCGTTTTGCTTCACGGAGGAACTCATATTGCTTGTGACTTCCCCAAGATGGCCAACGCAAACAGT
CGTATATTTCTTGATACTATTGGGCATGGTTTCCACGGCCGGCAACCATCTTTCCTTGGCATATTGGCTTCGATTGAGGGGATTACGGGGATTATCATGGTGGTCCTGATGTCAATAGCT
TTTCTTCTTGCAACGCACTGGTCCCGCAAGAACATCGTCAGGCTCCCTTGGCCCCTCCACAGGTTAACAGGATTCAACGCATTTTGGTACTCGCATCATCTTTTTATTTTGGTCTACGCC
TTGCTGATCATACACTCGGTGTTTCTCTTCCTGACCCCAGACTGGCTGCAAAAGACG
ACGTGGATATATCTATCCTGTCCATTGCTGCTGTACGTTGGCGAGAGGTTCCTGCGCGTTTTA
AGATCGAGGCAGCATCGAGTCAACATAGTAAAG
GCAGCAATTCATCCTGGCAACGTTCTTGCCTTGGACATGACGAAACCTCCAGGCTTCAAGTATCGGAGTGGCATGTACATGTTTCTG
CAGTGTCCAGCGATCTCGCCATTCGAGTG
GCATCCCTTCTCGATCACGTCTGCGCCCGACGACGAGTTTTTAAATGTGCACATACGGACAGTGGGGGACTGGACCAAGGAAATGAGGAAA
ATGTTTGCAAAGGTTTGTTTGCTTCCCCTTCAATGCCT
GTTTCCAAAGCTCTACATTGATGGACCTTATGGCGCTCCTGCTCAGGACTACCGGAAGTATGACGTGATGCTCCTCGTTGGC
TTGGGAATCGGAGCTACACCTTTTATCAGCATCTTAAAGGACATGCTCAACAACATCAAATCCACGGAGCAACAGTCGGTAAGCTTCTCTCTTTTGTTTTCTAGTTCTTTTCTTAGCACA
AGTT
ACTTTAGCAAGCCGTTTGATAGCCCGAGAAGAAAGAGCCGCAAGTCTCGTGGCCCAACAAACGCCTACTTCTACTGGGTCACCAGAGAGCAAGGCTCGTTCGAGTGGTTCAAAGGC
GTCATGAATGAGGTGGCCGAAATAGATCACAAG
GCAGTAATTGAGATGCACAACTACCTCACAAGCGTGTACGAGGAAGGTGACGCGCGCTCGGCTCTCATTGCAATGGTACAAGCTCTA
CACCACACCAAAAACGGCGTGGATATCGTCTCGGGCACCCGG
GCACGCACTCACTTCGCAAGGCCAAACTGGGACAAGGTGTTTGCACGTCTCACTGCTACACACGACAATTCAAGGATA
G
GAGTGTTCTACTGCGGGCCTTCGCAAGTCGCCAAAGAGTTAGATGTGCTGTCCCGGAAGTATTCCCAAGAGTCCAACACCAAATTTATATTCCATAAGGAGAACTTTTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCTCA AGAAGGTGGG GCGCAATGGG AGCTCCGCGC GGATCTTGCC GCTGAATTTC TCCCCGGATG GCGAGGGCGG CCAGCTCTCG AGATCGATGT CCGGCACGGA GTATGCGATC  GAGGGCTTGC GCTTCATCGA GAAGACAATT GCCAGCAAGA ACGCAAAGTC TCAGTGGGAG GCTGTGGAGC TTAGATTTCA CAAGCTCGCC AACGAGGAGT GTCGGCTTTC ACGCTCGGAC  TTTGGGGAAT GCATTGGAAT GAGCGATTCC AAGGAATTTG CGGAGTTGCT GTTTGATGCT CTAGCCCGGC GGAAAGGCCA TGACGAGCTG TGGACCGCTT CGAAGGAAGA ACTCCGGGAC  TTTTGGCTTC AAATCACAGA CAAGAGATTT AGCTCTCGAT TGCAAACATT TTTTGACTTG TGTGACACGG ATCTGGACGG TCGCATATCA GAAAACGAAG TGAAAGAGAT AATTCTACTC  AGTGCGTCGG CGAACAAGCT CTCGTTTCTG CAAGAGCAAG CTGAAGAATA CGCAGCTCTC ATCATGGGAG AACTCGATCA GAATAAACAA GGATACATTG AGGTGAAACA ACTTGAACGG  TTGATGCGAG AGCCGATCGC ACTCGCTGAG GATCCGTCCT ATGGGTACGC GTGTGCTCCA ACTTTACACT CTCGAAGAAG AAACCGATTG CATTTACTCC AGAGAACGAT CAAGTACTTC  GCTCTGGACA ACTGGCAGCG GATATGGGTG CTGTGCGTGT GGTTTCTCGC CATGACCGGT CTTTTCACCT GGAAGTTCAT AGAGTACAAG AACAGAGCCG CTTTTAAGAT CATGGGATAC  TGTGTGTGCA CGGCCAAGGG CGCTGCGGAG ACTTTGAAAC TCAACATGGC ATTGGTCCTG CTGCCAGTTT GCAGGATCAC AATCACGTCC TTACGCTCCA CTGTTTTCGG ATCCATACTA  CCTTTCAACG ACAACATCAA CTTTCACAAG CTTATTGCTG CAGCGATTTT GTTCGGCGTT TTGCTTCACG GAGGAACTCA TATTGCTTGT GACTTCCCCA AGATGGCCAA CGCAAACAGT  CGTATATTTC TTGATACTAT TGGGCATGGT TTCCACGGCC GGCAACCATC TTTCCTTGGC ATATTGGCTT CGATTGAGGG GATTACGGGG ATTATCATGG TGGTCCTGAT GTCAATAGCT  TTTCTTCTTG CAACGCACTG GTCCCGCAAG AACATCGTCA GGCTCCCTTG GCCCCTCCAC AGGTTAACAG GATTCAACGC ATTTTGGTAC TCGCATCATC TTTTTATTTT GGTCTACGCC  TTGCTGATCA TACACTCGGT GTTTCTCTTC CTGACCCCAG ACTGGCTGCA AAAGACGACG TGGATATATC TATCCTGTCC ATTGCTGCTG TACGTTGGCG AGAGGTTCCT GCGCGTTTTA  AGATCGAGGC AGCATCGAGT CAACATAGTA AAGGCAGCAA TTCATCCTGG CAACGTTCTT GCCTTGGACA TGACGAAACC TCCAGGCTTC AAGTATCGGA GTGGCATGTA CATGTTTCTG  CAGTGTCCAG CGATCTCGCC ATTCGAGTGG CATCCCTTCT CGATCACGTC TGCGCCCGAC GACGAGTTTT TAAATGTGCA CATACGGACA GTGGGGGACT GGACCAAGGA AATGAGGAAA  ATGTTTGCAA AGGTTTGTTT GCTTCCCCTT CAATGCCTGT TTCCAAAGCT CTACATTGAT GGACCTTATG GCGCTCCTGC TCAGGACTAC CGGAAGTATG ACGTGATGCT CCTCGTTGGC  TTGGGAATCG GAGCTACACC TTTTATCAGC ATCTTAAAGG ACATGCTCAA CAACATCAAA TCCACGGAGC AACAGTCGGT AAGCTTCTCT CTTTTGTTTT CTAGTTCTTT TCTTAGCACA  AGTTACTTTA GCAAGCCGTT TGATAGCCCG AGAAGAAAGA GCCGCAAGTC TCGTGGCCCA ACAAACGCCT ACTTCTACTG GGTCACCAGA GAGCAAGGCT CGTTCGAGTG GTTCAAAGGC  GTCATGAATG AGGTGGCCGA AATAGATCAC AAGGCAGTAA TTGAGATGCA CAACTACCTC ACAAGCGTGT ACGAGGAAGG TGACGCGCGC TCGGCTCTCA TTGCAATGGT ACAAGCTCTA  CACCACACCA AAAACGGCGT GGATATCGTC TCGGGCACCC GGGCACGCAC TCACTTCGCA AGGCCAAACT GGGACAAGGT GTTTGCACGT CTCACTGCTA CACACGACAA TTCAAGGATA 
GGAGTGTTCT ACTGCGGGCC TTCGCAAGTC GCCAAAGAGT TAGATGTGCT GTCCCGGAAG TATTCCCAAG AGTCCAACAC CAAATTTATA TTCCATAAGG AGAACTTTTA G 

Retrieve as FASTA