Entry information : SmRboh02-1_19 ( SmRboh02a_19)
Entry ID 7386
Creation 0000-00-00 (Christophe Dunand)
Last sequence changes 2016-02-10 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-10 (Achraf Jemmat)
Peroxidase information: SmRboh02-1_19 ( SmRboh02a_19)
Name (synonym) SmRboh02-1_19 ( SmRboh02a_19)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmRboh02-1_19
start..stop
S start..stop
SmRboh02-2_137 1824 0 1..895 1..902
SmRboh05-1_24 1149 0 55..895 27..901
SmRboh05-2_69 1144 0 55..895 27..902
SmRboh01-1_52 1080 0 83..895 56..884
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1125474..1125724 251 N° 2 1125315..1125374 60 N° 3 1125004..1125218 215 N° 4 1124761..1124923 163
N° 5 1124646..1124694 49 N° 6 1124479..1124592 114 N° 7 1123960..1124373 414 N° 8 1123058..1123444 387
N° 9 1122725..1122820 96 N° 10 1122528..1122643 116 N° 11 1122328..1122430 103 N° 12 1121866..1122267 402
N° 13 1121685..1121813 129 N° 14 1121535..1121613 79 N° 15 1121348..1121457 110  
complement(join(1121348..1121457,1121535..1121613,1121685..1121813,1121866..1122 267,1122328..1122430,1122528..1122643,1122725..1122820,1123058..1123444,1123960. .1124373,1124479..1124592,1124646..1124694,1124761..1124923,1125004..1125218,112 5315..1125374,1125474..1125724))


exon

Literature and cross-references SmRboh02-1_19 ( SmRboh02a_19)
DNA ref. Phytozome 11:   scaffold_19 (1125724..1121348)
mRNA ref. JGI transcript:   97417
Protein sequence: SmRboh02-1_19 ( SmRboh02a_19)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   895
PWM (Da):   %s   100845.93 Transmb domain:   %s   o337-359i386-408o423-442i479-501o521-543i704-721o
PI (pH):   %s   9.85
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRQGRSSHQAQELSIHPSYGGQGGGGGGGAHIATVPLRWDQALDHSSGGGAIAQHHFVEVTLDVRDDSVKLRSVNPTIAAAAVQSLRSSLKRTASNTSSRMKQLSGGVHAGSSRPRYLSRSKSGAENALHGLRFITKAGANAADRSALWKSVEERFDKLASPEGLLKRGDFGQCGMKDSKEFAGELFDALARKKGMTNAEQISKRDLYEFWLQISDQSFDARMQIFFDMCDKNADGRISEEEVKVIMLSASANKLSKLKEQAEEYAALIMEELDPDNLGYIELWQLEQLMRGAPIGGYSRDLQQLNYSQTLVAPRRRNPIRALSRSTRNYVTEHWQRIWVVSVWLAAMVALFTWKFVQYKNRAAFEIMGYCVCAAKGAAETLKLNMALILLPVCRNLITTLRSTWLGLVVPFDDNINFHKAITIGIAFGVIIHGGVHLACDFPRIVQASDEDFNAKIGRGWHYEKPSYMDIVKSVTGITGIIMVVLMIIAFTLATRWFRRSLVKLPWPFHRLTGFNAFWYSHHLFVIVYVCLIVHSFKLFLSFKFKDKTTWMYLSVPLLLYTGERTLRYFRSGNYSVQILKAAIYTGNVLALHMTKPPGFKYKSGMYLFLKCPAISPFEWHPFSITSAPGDDFVSVHIRVLGDWTQEMKRIFSVCEPPIGNKSGLLRAEYIVGAASRNKFPKLLIDGPYGAPAQDYRKYDVLLLVGLGIGATPFISILRDMLNHIKTSDHPSPSDSVHIDMIRAMESPRRRKRRGPTNAYFYWVTREQGSFDWFKGVMNEVAEIDQKAVIEMHNYLTSVYEEGDARSALITMVQALHHAKNGVDIVSGTRVRTHFAKPNWRKVFSRLASTHPDSRIGVFFCGSSLLAKELDQISREYTYKTSTRFEFHKEHF

Retrieve as FASTA  
Remarks Complete sequence from genomic (14 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGACAGGGAAGATCCAGCCACCAAGCACAAGAGCTCTCGATTCATCCCAGCTATGGAGGCCAAGGAGGAGGAGGAGGAGGGGGAGCTCACATCGCAACAGTGCCACTGCGATGGGAC
CAGGCGCTGGATCACAGCAGTGGCGGTGGCGCCATCGCCCAGCACCACTTCGTGGAGGTGACGCTGGACGTGCGCGACGACTCGGTGAAGCTGAGGAGCGTGAATCCCACCATCGCCGCC
GCCGCGGTGCA
GTATAGCGGCGGCGGCGGCGAGGAGCACCCCGAGAGGAACCTCCTCGCGTCCGCGCCGGCGGTGGCGCTGGATCACCAGCAGCACTGGGCGGACAAGAGATCGCTGCGC
AGCTCGCTCAAGCGCACCGCCTCCAACACGTCCAGCCGGATGAAGCAGCT
GTCCCAGGAGCTCAAGCACGCGGCCGCGCGCGTCCTCTCCTCGCGATTCAACCCCGACGCCATCGCCGCC
GCCGCCGCCGCCACGAGCTCCTCGAGCAGCGGTGGTGTGCATGCTGGCTCTTCGCGGCCCAGGTACCTCTCGCGATCCAAGTCGGGCGCCGAGAACGCGCTCCACGGGCTGCGATTCATC
ACCAAGGCCGGCGCCAACGCGGCCGATCGATCCGCGCTGTGGAAGAGCGTGGAGGAGCGATTCGACAAGCTGGCGTCGCCCGAGGGGCTGCTCAAGCGCGGCGATTTCGGGCAATGCATT
G
GTAAGAGAGATCCTTCCTCCTCCTTTCTCCTCTCTCCTTTCTTTCTTCCTTGGATCGATTGATCGATAGATGGGTTGCAGGGATGAAGGACTCCAAGGAGTTTGCGGGCGAGCTCTTCG
ACGCGCTGGCGAGGAAGAAGGGGATGACCAACGCGGAGCAAATCTCCAAGCGGGATCTCTACGAGTTTTGGCTCCAGATCTCGGATCAGAGCTTCGATGCGCGAATGCAGATCTTTTTCG
ACAT
GTAAGGATGGAAATCTCTCTTCTCGCAGCTGTTCTTGAGCTCTTTCTTTTGTGTTCTTCTATCCAGGTGTGACAAGAATGCCGATGGCCGGATCTCCGAGGAGGAAGTCAAGGAGG
TAAGCTAACGAAACCCAATTGCGAGCTCTCTCTCACGATTCCGTCGATCCAGGTGATCATGCTCAGCGCCTCCGCCAACAAGCTCTCCAAGCTCAAGGAGCAAGCCGAGGAGTACGCCGC
GCTGATCATGGAGGAGCTCGATCCCGACAACTTGGGCTACATCGAG
GTGAGCAATCCATTCCATCCGATCCATGCAATCTCCCAGGAACGATCGATAGATCAAGAACCAAGTACCAAGAA
CCAATCGTTTTCTTGTTCTTCCTTCTTCCAGCTATGGCAGCTAGAGCAGCTGATGCGAGGAGCGCCGATCGGGGGCTACAGCCGCGATCTCCAGCAGCTCAACTACAGCCAGACGCTGGT
GGCGCCGCGGCGGCGGAATCCAATCCGCGCCTTGTCGCGCAGCACCAGGAACTACGTGACCGAGCACTGGCAGAGGATCTGGGTGGTGTCGGTGTGGCTGGCGGCCATGGTGGCGCTCTT
CACCTGGAAGTTCGTGCAGTACAAGAACCGTGCCGCGTTTGAGATCATGGGCTACTGCGTGTGCGCCGCCAAGGGCGCCGCGGAGACGCTCAAGCTCAACATGGCGCTCATCTTGCTCCC
GGTTTGTAGGAACCTCATCACCACCTTGCGATCGACCTGGCTGGGCCTCGTCGTCCCTTTCGACGACAACATCAACTTCCACAAA
GTAAGTCACCCATCGTAAGTTCTTTCTTTGATTGC
TCGATCCTTCGTGTCCTTGCTTCCCATTTTCTTGGGGCTCTTGCTTGTCTACTGTTCTTCGCAAGCTTCCAGATTTTTCCATTTTCTTGGGACTCCTTTGCGGATGTGTTCTTCAAGTTT
CCAGAGTTTGTGTGTTTTACTTTGCATTCTTCATGGGTGGCAAACTCTCTTTCCTCTCTCTGAAAGCTTTGAGCGATCTCTTTGCATGGCTGCATTTGCTTCCGTGAGGTCGTCGAGTTT
TCTTTGCCTTAGTTCTTCGCAAACCTCTCTTCTCTCCTCTCTCCATGGTCGTGCAAGTTCCGAGTTTGAGTGTTTTTCTTCGCATTCTTCATGTGTGTTACTGGCAAAGTCTCTCGTTTC
CTTCGCTCTGCTTGATCAATCTCTTTGCGAAAGTTTACTTTGCCTTCGTTCTTCGCAAGAGAAAACTTGCCTTCGTTCTTCGCAAACTGCTCTTTCTCACACTTTCCAACGTTTTACCAG

GCGATTACCATCGGGATTGCTTTCGGAGTTATCATCCATGGCGGTGTCCACCTTGCCTGCGACTTCCCCCGGATCGTGCAAGCCTCGGACGAGGATTTTAACGCCAAGATTGGCCGCGGC
TGGCACTACGAGAAGCCGAGCTACATGGACATTGTCAAGTCGGTGACGGGGATCACCGGGATCATCATGGTGGTGCTCATGATCATTGCCTTCACGCTCGCCACCCGCTGGTTCCGCCGG
AGCCTCGTTAAGTTACCATGGCCCTTCCATCGCCTTACGGGGTTCAACGCCTTTTGGTACTCGCACCACCTCTTTGTCATCGTCTACGTCTGTCTCATCGTCCACAGCTTCAAGCTCTTC
TTGAGCTTCAAGTTCAAGGATAAAACC
GTAAGTTTGTCCATCTTTCTTCCTGCTTGTGGATGAACTTCATTGATCCTATCCATCTTTCTTCCTGCTTTGGTTGTTTTTTGTGTTTGGTTG
CTCGTTTGTTTCCATTGATTCGCTCGCGCTTTTTTCTTTTTTCTTCTTTTTTCTTCGTCATTTCGATCGTAATGCGTTGGATTCTTCCTTGCATCGGATTCCACCACTCACTACAGTTGT
GTGCTTTCTTTTTTGAGCTCCCAGACTTGGATGTACCTCAGCGTGCCGTTGCTTCTTTACACCGGGGAGCGAACTTTGAGATACTTTCGATCAGGGAATTACTCTGTACAGATTCTCAAG
GTACGTGAGAAACTTGAGTAGAGAAAGAAAAGATTGATCAAACCGTGTTCCTCTTCTTTTGTGTTTTTTTTATGGTTGCAGGCTGCGATCTACACTGGAAACGTTTTGGCTTTGCACATG
ACGAAGCCACCTGGGTTCAAGTATAAAAGCGGCATGTATCTCTTCCTTAAATGCCCAGCAATCTCACCGTTCGAGTG
GTAAATTTCTTCTCCTTCCTTTTTTTTCTTGCTCGTTCCACCA
GTTCCATAAGACTTTTGTGTGTTTTTCTTGTCTGTGCATTTATTGTCCGTCCAGGCATCCGTTTTCCATAACCTCCGCCCCTGGAGACGACTTCGTGAGCGTACATATCCGAGTTCTTGG
CGACTGGACGCAGGAGATGAAGCGAATCTTCTCCGAG
GTAAAGTCATCGTTAAGTTGATCCAAGCTTTGCTTCATCTTTTTTCTCGTCTCACTGCAGGTGTGTGAGCCACCGATTGGAAA
CAAGAGTGGCCTTCTCCGAGCCGAGTACATCGTTGGCGCGGCGTCGCGGAACAAGTTTCCAAAGCTGTTGATCGACGGGCCTTACGGAGCTCCGGCGCAGGACTACCGGAAGTACGATGT
GTTGCTACTGGTCGGACTGGGCATTGGAGCCACCCCGTTCATCAGCATCCTCCGGGACATGCTCAACCACATCAAAACTTCCGACCACCCATCGCCAAGCGACTCCGTCCACATTGACAT
GATCCGGGCCATGGAGAGCCCGCGGAGGCGAAAGAGGCGAGGCCCGACCAACGCCTACTTCTACTGGGTGACGAGAGAGCAGGGATCTTTCGACTGGTTCAAAGGCGTGATGAATGAAGT
TGCCGAGATCGATCAAAAG
GTGGTTTTCTCTTTCGAGACTTTGTTGTCACTATTATCATCTTTCTCTCCAGGCTGTGATTGAGATGCACAACTATTTGACGAGCGTTTACGAGGAGGGCG
ACGCAAGGTCTGCGTTGATCACCATGGTGCAAGCTCTCCACCATGCCAAGAATGGTGTGGACATTGTCTCGGGAACCAGA
GTAAATAGTTTTTTTCCTTTGCTTCCTCTCTCGTGATGGT
TTTTGATGTTTGTTTTGCTCTCTTGTGCTAGGTACGCACGCACTTTGCCAAGCCAAACTGGAGGAAAGTATTCTCCAGGCTCGCAAGCACGCATCCGGATTCTAGAATTGGTAAGAGTTT
CTCGCTTTGAAAGTTCTCTCATAGTTAGAAAACCAAGATCTAAGATCGAGCTCTCTGTCGAATCCAGGCGTATTCTTTTGCGGATCGTCTCTTCTGGCCAAAGAGCTGGACCAGATATCG
CGCGAGTACACGTATAAGACGAGCACCAGATTTGAGTTCCACAAAGAACACTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGACAGGGAAGATCCAGCCACCAAGCACAAGAGCTCTCGATTCATCCCAGCTATGGAGGCCAAGGAGGAGGAGGAGGAGGGGGAGCTCACATCGCAACAGTGCCACTGCGATGGGAC
CAGGCGCTGGATCACAGCAGTGGCGGTGGCGCCATCGCCCAGCACCACTTCGTGGAGGTGACGCTGGACGTGCGCGACGACTCGGTGAAGCTGAGGAGCGTGAATCCCACCATCGCCGCC
GCCGCGGTGCA
ATCGCTGCGCAGCTCGCTCAAGCGCACCGCCTCCAACACGTCCAGCCGGATGAAGCAGCTCAGCGGTGGTGTGCATGCTGGCTCTTCGCGGCCCAGGTACCTCTCGCGA
TCCAAGTCGGGCGCCGAGAACGCGCTCCACGGGCTGCGATTCATCACCAAGGCCGGCGCCAACGCGGCCGATCGATCCGCGCTGTGGAAGAGCGTGGAGGAGCGATTCGACAAGCTGGCG
TCGCCCGAGGGGCTGCTCAAGCGCGGCGATTTCGGGCAATGCATTG
GGATGAAGGACTCCAAGGAGTTTGCGGGCGAGCTCTTCGACGCGCTGGCGAGGAAGAAGGGGATGACCAACGCG
GAGCAAATCTCCAAGCGGGATCTCTACGAGTTTTGGCTCCAGATCTCGGATCAGAGCTTCGATGCGCGAATGCAGATCTTTTTCGACAT
GTGTGACAAGAATGCCGATGGCCGGATCTCC
GAGGAGGAAGTCAAGGAG
GTGATCATGCTCAGCGCCTCCGCCAACAAGCTCTCCAAGCTCAAGGAGCAAGCCGAGGAGTACGCCGCGCTGATCATGGAGGAGCTCGATCCCGACAACTTG
GGCTACATCGAG
CTATGGCAGCTAGAGCAGCTGATGCGAGGAGCGCCGATCGGGGGCTACAGCCGCGATCTCCAGCAGCTCAACTACAGCCAGACGCTGGTGGCGCCGCGGCGGCGGAAT
CCAATCCGCGCCTTGTCGCGCAGCACCAGGAACTACGTGACCGAGCACTGGCAGAGGATCTGGGTGGTGTCGGTGTGGCTGGCGGCCATGGTGGCGCTCTTCACCTGGAAGTTCGTGCAG
TACAAGAACCGTGCCGCGTTTGAGATCATGGGCTACTGCGTGTGCGCCGCCAAGGGCGCCGCGGAGACGCTCAAGCTCAACATGGCGCTCATCTTGCTCCCGGTTTGTAGGAACCTCATC
ACCACCTTGCGATCGACCTGGCTGGGCCTCGTCGTCCCTTTCGACGACAACATCAACTTCCACAAA
GCGATTACCATCGGGATTGCTTTCGGAGTTATCATCCATGGCGGTGTCCACCTT
GCCTGCGACTTCCCCCGGATCGTGCAAGCCTCGGACGAGGATTTTAACGCCAAGATTGGCCGCGGCTGGCACTACGAGAAGCCGAGCTACATGGACATTGTCAAGTCGGTGACGGGGATC
ACCGGGATCATCATGGTGGTGCTCATGATCATTGCCTTCACGCTCGCCACCCGCTGGTTCCGCCGGAGCCTCGTTAAGTTACCATGGCCCTTCCATCGCCTTACGGGGTTCAACGCCTTT
TGGTACTCGCACCACCTCTTTGTCATCGTCTACGTCTGTCTCATCGTCCACAGCTTCAAGCTCTTCTTGAGCTTCAAGTTCAAGGATAAAACC
ACTTGGATGTACCTCAGCGTGCCGTTG
CTTCTTTACACCGGGGAGCGAACTTTGAGATACTTTCGATCAGGGAATTACTCTGTACAGATTCTCAAG
GCTGCGATCTACACTGGAAACGTTTTGGCTTTGCACATGACGAAGCCACCT
GGGTTCAAGTATAAAAGCGGCATGTATCTCTTCCTTAAATGCCCAGCAATCTCACCGTTCGAGTG
GCATCCGTTTTCCATAACCTCCGCCCCTGGAGACGACTTCGTGAGCGTACATATC
CGAGTTCTTGGCGACTGGACGCAGGAGATGAAGCGAATCTTCTCCGAG
GTGTGTGAGCCACCGATTGGAAACAAGAGTGGCCTTCTCCGAGCCGAGTACATCGTTGGCGCGGCGTCGCGG
AACAAGTTTCCAAAGCTGTTGATCGACGGGCCTTACGGAGCTCCGGCGCAGGACTACCGGAAGTACGATGTGTTGCTACTGGTCGGACTGGGCATTGGAGCCACCCCGTTCATCAGCATC
CTCCGGGACATGCTCAACCACATCAAAACTTCCGACCACCCATCGCCAAGCGACTCCGTCCACATTGACATGATCCGGGCCATGGAGAGCCCGCGGAGGCGAAAGAGGCGAGGCCCGACC
AACGCCTACTTCTACTGGGTGACGAGAGAGCAGGGATCTTTCGACTGGTTCAAAGGCGTGATGAATGAAGTTGCCGAGATCGATCAAAAG
GCTGTGATTGAGATGCACAACTATTTGACG
AGCGTTTACGAGGAGGGCGACGCAAGGTCTGCGTTGATCACCATGGTGCAAGCTCTCCACCATGCCAAGAATGGTGTGGACATTGTCTCGGGAACCAGA
GTACGCACGCACTTTGCCAAG
CCAAACTGGAGGAAAGTATTCTCCAGGCTCGCAAGCACGCATCCGGATTCTAGAATTG
GCGTATTCTTTTGCGGATCGTCTCTTCTGGCCAAAGAGCTGGACCAGATATCGCGCGAGTAC
ACGTATAAGACGAGCACCAGATTTGAGTTCCACAAAGAACACTTCTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGACAGG GAAGATCCAG CCACCAAGCA CAAGAGCTCT CGATTCATCC CAGCTATGGA GGCCAAGGAG GAGGAGGAGG AGGGGGAGCT CACATCGCAA CAGTGCCACT GCGATGGGAC  CAGGCGCTGG ATCACAGCAG TGGCGGTGGC GCCATCGCCC AGCACCACTT CGTGGAGGTG ACGCTGGACG TGCGCGACGA CTCGGTGAAG CTGAGGAGCG TGAATCCCAC CATCGCCGCC  GCCGCGGTGC AATCGCTGCG CAGCTCGCTC AAGCGCACCG CCTCCAACAC GTCCAGCCGG ATGAAGCAGC TCAGCGGTGG TGTGCATGCT GGCTCTTCGC GGCCCAGGTA CCTCTCGCGA  TCCAAGTCGG GCGCCGAGAA CGCGCTCCAC GGGCTGCGAT TCATCACCAA GGCCGGCGCC AACGCGGCCG ATCGATCCGC GCTGTGGAAG AGCGTGGAGG AGCGATTCGA CAAGCTGGCG  TCGCCCGAGG GGCTGCTCAA GCGCGGCGAT TTCGGGCAAT GCATTGGGAT GAAGGACTCC AAGGAGTTTG CGGGCGAGCT CTTCGACGCG CTGGCGAGGA AGAAGGGGAT GACCAACGCG  GAGCAAATCT CCAAGCGGGA TCTCTACGAG TTTTGGCTCC AGATCTCGGA TCAGAGCTTC GATGCGCGAA TGCAGATCTT TTTCGACATG TGTGACAAGA ATGCCGATGG CCGGATCTCC  GAGGAGGAAG TCAAGGAGGT GATCATGCTC AGCGCCTCCG CCAACAAGCT CTCCAAGCTC AAGGAGCAAG CCGAGGAGTA CGCCGCGCTG ATCATGGAGG AGCTCGATCC CGACAACTTG  GGCTACATCG AGCTATGGCA GCTAGAGCAG CTGATGCGAG GAGCGCCGAT CGGGGGCTAC AGCCGCGATC TCCAGCAGCT CAACTACAGC CAGACGCTGG TGGCGCCGCG GCGGCGGAAT  CCAATCCGCG CCTTGTCGCG CAGCACCAGG AACTACGTGA CCGAGCACTG GCAGAGGATC TGGGTGGTGT CGGTGTGGCT GGCGGCCATG GTGGCGCTCT TCACCTGGAA GTTCGTGCAG  TACAAGAACC GTGCCGCGTT TGAGATCATG GGCTACTGCG TGTGCGCCGC CAAGGGCGCC GCGGAGACGC TCAAGCTCAA CATGGCGCTC ATCTTGCTCC CGGTTTGTAG GAACCTCATC  ACCACCTTGC GATCGACCTG GCTGGGCCTC GTCGTCCCTT TCGACGACAA CATCAACTTC CACAAAGCGA TTACCATCGG GATTGCTTTC GGAGTTATCA TCCATGGCGG TGTCCACCTT  GCCTGCGACT TCCCCCGGAT CGTGCAAGCC TCGGACGAGG ATTTTAACGC CAAGATTGGC CGCGGCTGGC ACTACGAGAA GCCGAGCTAC ATGGACATTG TCAAGTCGGT GACGGGGATC  ACCGGGATCA TCATGGTGGT GCTCATGATC ATTGCCTTCA CGCTCGCCAC CCGCTGGTTC CGCCGGAGCC TCGTTAAGTT ACCATGGCCC TTCCATCGCC TTACGGGGTT CAACGCCTTT  TGGTACTCGC ACCACCTCTT TGTCATCGTC TACGTCTGTC TCATCGTCCA CAGCTTCAAG CTCTTCTTGA GCTTCAAGTT CAAGGATAAA ACCACTTGGA TGTACCTCAG CGTGCCGTTG  CTTCTTTACA CCGGGGAGCG AACTTTGAGA TACTTTCGAT CAGGGAATTA CTCTGTACAG ATTCTCAAGG CTGCGATCTA CACTGGAAAC GTTTTGGCTT TGCACATGAC GAAGCCACCT  GGGTTCAAGT ATAAAAGCGG CATGTATCTC TTCCTTAAAT GCCCAGCAAT CTCACCGTTC GAGTGGCATC CGTTTTCCAT AACCTCCGCC CCTGGAGACG ACTTCGTGAG CGTACATATC  CGAGTTCTTG GCGACTGGAC GCAGGAGATG AAGCGAATCT TCTCCGAGGT GTGTGAGCCA CCGATTGGAA ACAAGAGTGG CCTTCTCCGA GCCGAGTACA TCGTTGGCGC GGCGTCGCGG  AACAAGTTTC CAAAGCTGTT GATCGACGGG CCTTACGGAG CTCCGGCGCA GGACTACCGG AAGTACGATG TGTTGCTACT GGTCGGACTG GGCATTGGAG CCACCCCGTT CATCAGCATC  CTCCGGGACA TGCTCAACCA CATCAAAACT TCCGACCACC CATCGCCAAG CGACTCCGTC CACATTGACA TGATCCGGGC CATGGAGAGC CCGCGGAGGC GAAAGAGGCG AGGCCCGACC  AACGCCTACT TCTACTGGGT GACGAGAGAG CAGGGATCTT TCGACTGGTT CAAAGGCGTG ATGAATGAAG TTGCCGAGAT CGATCAAAAG GCTGTGATTG AGATGCACAA CTATTTGACG  AGCGTTTACG AGGAGGGCGA CGCAAGGTCT GCGTTGATCA CCATGGTGCA AGCTCTCCAC CATGCCAAGA ATGGTGTGGA CATTGTCTCG GGAACCAGAG TACGCACGCA CTTTGCCAAG  CCAAACTGGA GGAAAGTATT CTCCAGGCTC GCAAGCACGC ATCCGGATTC TAGAATTGGC GTATTCTTTT GCGGATCGTC TCTTCTGGCC AAAGAGCTGG ACCAGATATC GCGCGAGTAC 
ACGTATAAGA CGAGCACCAG ATTTGAGTTC CACAAAGAAC ACTTCTAA 

Retrieve as FASTA