Entry information : SmRboh04-2_88 (SmRboh04b_88)
Entry ID 7387
Creation 0000-00-00 (Christophe Dunand)
Last sequence changes 2010-06-01 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-02-23 (Christophe Dunand)
Peroxidase information: SmRboh04-2_88 (SmRboh04b_88)
Name (synonym) SmRboh04-2_88 (SmRboh04b_88)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmRboh04-2_88
start..stop
S start..stop
SmRboh04-1_39 1552 0 1..789 1..788
SmRboh03-2_66 1015 0 1..789 16..796
SmRboh02-1_19 995 0 33..789 128..895
SmRboh02-2_137 993 0 15..789 112..902
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 782073..782304 232 N° 2 781860..782019 160 N° 3 781751..781799 49 N° 4 781572..781685 114
N° 5 781111..781515 405 N° 6 779776..780162 387 N° 7 779622..779717 96 N° 8 779452..779567 116
N° 9 779215..779395 181 N° 10 778986..779135 150 N° 11 778758..778919 162 N° 12 778565..778693 129
N° 13 778316..778504 189  
complement(join(778316..778504,778565..778693,778758..778919,778986..779135,7792 15..779395,779452..779567,779622..779717,779776..780162,781111..781515,781572..7 81685,781751..781799,781860..782019,782073..782304))


exon

Literature and cross-references SmRboh04-2_88 (SmRboh04b_88)
DNA ref. Phytozome 11:   scaffold_88 (782304..778316)
mRNA ref. JGI transcript:   127954 [Incorrect prediction]
Protein sequence: SmRboh04-2_88 (SmRboh04b_88)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   789
PWM (Da):   %s   88956.92 Transmb domain:   %s   i235-257o321-343i371-393o419-441i599-616o
PI (pH):   %s   9.5
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPVDFSPDREPPAAAAAAAAAAAPPAIATTSRAIEGLRFIDKSNRDTNWETVDARFRKLSAGRPDGRLARSDFGACIGMKTKEFAGQLFDALSRRRGKEGLTSIGREELSDYWLDMTDKRFDSRMRIFFDLCDKDLDGRIFEDEVKVILLSASANRLSILEEQAEEYAALIMEELDREKNGYIGLLQLEGLLRSPSACDHQSQMISSSATLPKSAIGRMESLRRRARVVLLDDWQRVWMIALWFAVMAVLFSWKFIQYSYRSGFPVMGYCLCTAKGAAETLKLNMALILLPVCRNTITWLRSTALATIVPFDDNINFHKLVAAAIVIGVFLHGGVHLTCDFYRISSADYIKFIQTLGVNFKFAQPTYLDLVLSIEGMTGIIMVLLMIIAFLLATHWSRRNLVKLHWPFHRLTGFNAFWYSHHLFVLVYGLLIVHSFFLFLARDWREKTAWMYIAIPALLYTGERTLRTLRACTYKVSIVKASIYSGNVLALYMTKPPGFRYQSGMYLFLQCPAVSPFEWHPFSITSAPGDEYVSVHIRSLGDWTQELMKIFSQVSFPGERFQGLSAFLAGCRSAKRAALCVDGPYGAPSQDFKKYDILLLVGLGIGATPFISILRDMLNHLKSAEQLPGSQSPFSKMFDAARKKAKKNRGPTNAYFYWVTREQSSFEWFKGVMNEVSQLDHKAVIEMHNYLTSVYEEGDARSTLIGLVQALHHARSGVDIVSGTRVRTHFARPNWRKVFARLASIHPGARIGVFYCGNSAAGKELDLLSRSYSEKSNTKFIFHKEKF*

Retrieve as FASTA  
Remarks Complete sequence from genomic (12 introns). Incorrect prediction from JGI (splicing error confirmed with EST).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCAGTGGATTTCTCGCCCGATCGAGAGCCCCCAGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCTCCACCCGCGATCGCCACAACCAGTCGCGCGATCGAGGGGCTTCGCTTCATC
GACAAGTCCAACCGCGACACGAATTGGGAGACGGTGGATGCGCGATTCCGGAAGCTTAGCGCTGGCAGGCCCGATGGGAGGCTGGCGAGATCGGATTTTGGGGCGTGCATCG
GTGAGTTC
TCTCTGTTCTTGGCTGGAAACTCTCTGATCGCGCGCTCGCTCCAGGGATGAAAACCAAGGAGTTTGCCGGGCAGCTCTTCGATGCATTGTCGCGGCGGCGAGGCAAGGAGGGATTGACGA
GCATTGGGCGAGAAGAGCTGAGCGATTACTGGCTCGACATGACGGACAAGCGCTTCGATTCGCGAATGCGCATCTTCTTCGACCT
GTAAGGCGCTGATTTCTTGCGATTTCTTCCTGTCG
CTGATGCGATCGTGCTGCCACGCAGCTGCGACAAGGATCTGGACGGGCGAATCTTCGAGGACGAGGTAAAAGAGGTAAGAACCTTTCTATCCCAGCAAATGCCGTGTCTGGGTATCTTGG
ACTGAGCGAGTGATTCCAGGTGATCTTGCTCAGTGCGTCCGCGAATCGGCTCTCGATCCTCGAGGAGCAGGCGGAGGAGTACGCGGCACTCATCATGGAGGAGCTTGATCGCGAGAAGAA
CGGCTACATTGGC
GTAAGATCATCACTCTTTCACCCATCCAAGCTTACGTGAATCTCTTGGATCTCCAGTTGCTCCAGCTCGAGGGACTGCTGCGAAGCCCCAGCGCCTGCGACCACCAG
AGCCAGATGATAAGCTCCTCGGCGACGCTGCCCAAGAGCGCTATCGGGAGGATGGAATCGCTGCGGCGGCGCGCGAGGGTGGTGCTCCTGGACGACTGGCAGCGCGTGTGGATGATCGCG
CTGTGGTTCGCGGTGATGGCGGTGCTCTTTAGCTGGAAGTTCATCCAGTATAGCTACCGCTCGGGGTTTCCAGTGATGGGCTACTGCCTGTGCACTGCCAAGGGCGCCGCCGAGACGCTC
AAGCTCAACATGGCGCTCATCCTTCTCCCGGTTTGCCGGAATACCATCACTTGGCTCAGATCCACCGCGCTCGCCACCATCGTTCCCTTTGACGATAACATCAACTTTCACAAG
GTTAGT
CTTCTCTCTTCTCTTTTGCTTCTTTGATCTTCGCCATAGCTGAGCATGTTTGTCCTACTAGCTTTTCTCTCTCTTTTTTTTGCTTCTTCTTTGGGCTCTTTTTTTTTTTGTTCTTTCTCG
TTCTACCAGTTTTTCCTTGGGTTTGCAGTGTTTTTGTGTGAGAATTCTTTCTCTGTGCTGCACTCTTGTCTAGATGGATCATATTTTGTTTTCTGGTTCTCTCCATCACGTTTTTGTTCT
TGATTCACATTTTTGCTGGCTGGATTGGATTAATGTTTTGCAACTTTGTTTTCCCTCCTTGTCTTCTGCAAAGTTTTTTTGTCTTTCTCCTTCGCGAACGCTGCTAACTGAGTTACTCCC
ACGCACATCTCCCTGATCATGTAAGCCAAGTTTTTCTTCCATGGCTGCCTGTTTTTTGTTTGGTTCTTCGTCACCGCGATGCGTCTCTCCTTTTGTTCCTGCTGCTTCGCTGCGTCCATC
TTTTGCAGTGGTTTGAGTTTTTTTGTTACAATTTCTTCGTACAAGTTCTTCGCTAAATCTTCACTGTGCTACTGCCATGAATTTTTTTTCACTACTCCCTGGCTTTTTGTTTTCACTCTT
CTGGTTGATTCTCTCCAGCTGGCTGCCTGTTGCTTGCTGGTCCCTGGTGTTTCTTTCCCTTGTGCCTTTATGCTTTTATTTTCTCTAGTTTCAATCAACCAGTTGATCATAATGTTCTCC
CTTGACTGATTGATTGTTCTTCGTGTGATCCTGACAGTGGAAAGCTAAAGTATTGTTTCGACCGTCTCTGGTACTTGGCTTGGGTAATGGGTGCTTTGTTGTATATGCCTTTCTTTATAC
TTTTCGTTGCTTCATCGTCATCGCCATTGTCGTCTTTTTTGCATTGAAGAATCTGAGCTTCTTACATGTTTCTTCTTCTTCTTCTTTTTTTCTGGAGATCAGCTGGTTGCAGCAGCAATC
GTGATTGGAGTTTTCCTCCACGGGGGAGTTCACTTAACCTGCGATTTTTACCGGATTTCCAGCGCGGACTACATCAAGTTCATACAGACACTAGGCGTGAACTTCAAGTTTGCCCAGCCG
ACGTACCTGGATTTGGTGCTTTCGATCGAGGGAATGACCGGGATTATCATGGTGCTGCTCATGATCATCGCGTTTTTGCTGGCCACGCACTGGTCCAGGAGAAATCTCGTCAAGCTCCAC
TGGCCATTCCACAGGTTGACGGGCTTCAATGCCTTTTGGTACTCGCACCACTTGTTCGTCCTCGTCTACGGTCTTCTCATCGTTCACTCCTTTTTCTTGTTCCTCGCTCGGGACTGGAGA
GAAAAAACG
GTAAATCACTTTTATTTTCTTCTTTGTGTCTCGTTGTTCTAAAGCTTTTCCTTCACAGGCTTGGATGTATATAGCTATACCCGCGCTCTTGTACACTGGCGAGAGGACTCT
ACGAACGCTGAGAGCTTGTACTTACAAAGTTAGCATTGTAAAG
GTAAACAAAGATGGAATTTTTGTCCAGTTTTGCTCACGATTTGCGATCTTTCAGGCATCCATTTATTCAGGAAACGT
TCTTGCTTTATACATGACTAAGCCTCCGGGTTTTAGATATCAAAGTGGAATGTATCTCTTCTTGCAATGCCCCGCAGTGTCGCCTTTCGAATG
GTAAGCTAGATTTGTGTATGTGTGGTT
CGCTTCTTAAGGATTTGTCTGTGTTACAGGCATCCATTCTCCATAACTTCGGCACCGGGAGATGAATATGTAAGTGTACACATACGCAGCCTCGGGGATTGGACGCAAGAGCTAATGAAG
ATCTTTTCTCAAGTAAGTTTTCCGGGAGAAAGATTTCAGGGCTTAAGTGCTTTTCTTGCAGGTTGTAGATCAGCCAAACGAGCAGCTCAA
GTAAGTTTTCTTAGCTTTTCGTATGATCTC
TAAAGTGTTTTCCTTTTTTTTAATCTTTGTCTCGTGTAGATATCCCAAGCTCTGTGTTGATGGACCATATGGAGCACCATCCCAGGATTTCAAAAAGTACGATATCCTATTGCTGGTGGG
ACTTGGAATTGGAGCAACACCATTTATAAGCATCCTGAGAGACATGTTGAATCATTTAAAGTCAGCCGAGCAGCTTCCT
GTAAGTATTTTATCTTCTTTTCTTTTTTCCTCCAGAAGCAA
TGAACTTACACACATTATCTTCCAGGGATCTCAAAGTCCATTCAGCAAGATGTTCGATGCTGCCAGAAAAAAAGCCAAGAAAAATAGAGGCCCCACGAACGCTTACTTCTACTGGGTCAC
CAGAGAGCAAAGCTCCTTTGAATGGTTCAAGGGAGTCATGAACGAAGTCTCTCAGCTTGATCACAAG
GTCAGGAAAACGTTTGTGATTTCTATCTCCTCCTTTTACAAATCGTTTTGGTG
CTTCTTTGCAGGCCGTGATCGAGATGCATAACTATCTAACGAGTGTTTACGAAGAAGGAGACGCTCGCTCCACGCTTATCGGTTTGGTCCAAGCGTTGCATCACGCACGAAGCGGTGTTG
ATATTGTCTCTGGCACTCGG
GTAAGTTCCTTTCTAGTTAATGTTCTTTCTTCTTATTTGTTCTTTCGATTTCTTCCCCAGGTTCGAACGCATTTTGCTCGTCCAAACTGGAGGAAAGTGT
TTGCGAGGCTTGCATCGATTCATCCAGGTGCCAGAATAGGTGTGTTTTACTGCGGAAACTCGGCAGCAGGAAAGGAGCTCGACCTTCTCTCGCGGTCTTACTCGGAGAAATCGAATACCA
AGTTCATTTTCCACAAGGAAAAGTTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCAGTGGATTTCTCGCCCGATCGAGAGCCCCCAGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCTCCACCCGCGATCGCCACAACCAGTCGCGCGATCGAGGGGCTTCGCTTCATC
GACAAGTCCAACCGCGACACGAATTGGGAGACGGTGGATGCGCGATTCCGGAAGCTTAGCGCTGGCAGGCCCGATGGGAGGCTGGCGAGATCGGATTTTGGGGCGTGCATCG
GGATGAAA
ACCAAGGAGTTTGCCGGGCAGCTCTTCGATGCATTGTCGCGGCGGCGAGGCAAGGAGGGATTGACGAGCATTGGGCGAGAAGAGCTGAGCGATTACTGGCTCGACATGACGGACAAGCGC
TTCGATTCGCGAATGCGCATCTTCTTCGACCT
CTGCGACAAGGATCTGGACGGGCGAATCTTCGAGGACGAGGTAAAAGAGGTGATCTTGCTCAGTGCGTCCGCGAATCGGCTCTCGATC
CTCGAGGAGCAGGCGGAGGAGTACGCGGCACTCATCATGGAGGAGCTTGATCGCGAGAAGAACGGCTACATTGGC
TTGCTCCAGCTCGAGGGACTGCTGCGAAGCCCCAGCGCCTGCGAC
CACCAGAGCCAGATGATAAGCTCCTCGGCGACGCTGCCCAAGAGCGCTATCGGGAGGATGGAATCGCTGCGGCGGCGCGCGAGGGTGGTGCTCCTGGACGACTGGCAGCGCGTGTGGATG
ATCGCGCTGTGGTTCGCGGTGATGGCGGTGCTCTTTAGCTGGAAGTTCATCCAGTATAGCTACCGCTCGGGGTTTCCAGTGATGGGCTACTGCCTGTGCACTGCCAAGGGCGCCGCCGAG
ACGCTCAAGCTCAACATGGCGCTCATCCTTCTCCCGGTTTGCCGGAATACCATCACTTGGCTCAGATCCACCGCGCTCGCCACCATCGTTCCCTTTGACGATAACATCAACTTTCACAAG
CTGGTTGCAGCAGCAATCGTGATTGGAGTTTTCCTCCACGGGGGAGTTCACTTAACCTGCGATTTTTACCGGATTTCCAGCGCGGACTACATCAAGTTCATACAGACACTAGGCGTGAAC
TTCAAGTTTGCCCAGCCGACGTACCTGGATTTGGTGCTTTCGATCGAGGGAATGACCGGGATTATCATGGTGCTGCTCATGATCATCGCGTTTTTGCTGGCCACGCACTGGTCCAGGAGA
AATCTCGTCAAGCTCCACTGGCCATTCCACAGGTTGACGGGCTTCAATGCCTTTTGGTACTCGCACCACTTGTTCGTCCTCGTCTACGGTCTTCTCATCGTTCACTCCTTTTTCTTGTTC
CTCGCTCGGGACTGGAGAGAAAAAACG
GCTTGGATGTATATAGCTATACCCGCGCTCTTGTACACTGGCGAGAGGACTCTACGAACGCTGAGAGCTTGTACTTACAAAGTTAGCATTGTA
AAG
GCATCCATTTATTCAGGAAACGTTCTTGCTTTATACATGACTAAGCCTCCGGGTTTTAGATATCAAAGTGGAATGTATCTCTTCTTGCAATGCCCCGCAGTGTCGCCTTTCGAATGG
CATCCATTCTCCATAACTTCGGCACCGGGAGATGAATATGTAAGTGTACACATACGCAGCCTCGGGGATTGGACGCAAGAGCTAATGAAGATCTTTTCTCAAGTAAGTTTTCCGGGAGAA
AGATTTCAGGGCTTAAGTGCTTTTCTTGCAGGTTGTAGATCAGCCAAACGAGCAGCTCAA
CTCTGTGTTGATGGACCATATGGAGCACCATCCCAGGATTTCAAAAAGTACGATATCCTA
TTGCTGGTGGGACTTGGAATTGGAGCAACACCATTTATAAGCATCCTGAGAGACATGTTGAATCATTTAAAGTCAGCCGAGCAGCTTCCT
GGATCTCAAAGTCCATTCAGCAAGATGTTC
GATGCTGCCAGAAAAAAAGCCAAGAAAAATAGAGGCCCCACGAACGCTTACTTCTACTGGGTCACCAGAGAGCAAAGCTCCTTTGAATGGTTCAAGGGAGTCATGAACGAAGTCTCTCAG
CTTGATCACAAG
GCCGTGATCGAGATGCATAACTATCTAACGAGTGTTTACGAAGAAGGAGACGCTCGCTCCACGCTTATCGGTTTGGTCCAAGCGTTGCATCACGCACGAAGCGGTGTT
GATATTGTCTCTGGCACTCGG
GTTCGAACGCATTTTGCTCGTCCAAACTGGAGGAAAGTGTTTGCGAGGCTTGCATCGATTCATCCAGGTGCCAGAATAGGTGTGTTTTACTGCGGAAAC
TCGGCAGCAGGAAAGGAGCTCGACCTTCTCTCGCGGTCTTACTCGGAGAAATCGAATACCAAGTTCATTTTCCACAAGGAAAAGTTCTAG

Retrieve as FASTA