Entry information : SmRboh05-1_24 (SmRboh05a_24)
Entry ID 7388
Creation 0000-00-00 (Christophe Dunand)
Last sequence changes 2010-06-01 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmRboh05-1_24 (SmRboh05a_24)
Name (synonym) SmRboh05-1_24 (SmRboh05a_24)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmRboh05-1_24
start..stop
S start..stop
SmRboh05-2_69 1831 0 1..901 1..902
SmRboh02-2_137 1168 0 27..901 62..902
SmRboh02-1_19 1166 0 27..901 55..895
CsRboh01 1048 0 28..901 37..946
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 910785..911343 559 N° 2 910472..910634 163 N° 3 910368..910416 49 N° 4 910137..910250 114
N° 5 909569..909982 414 N° 6 909118..909504 387 N° 7 908974..909066 93 N° 8 908806..908921 116
N° 9 908651..908753 103 N° 10 908340..908582 243 N° 11 908053..908199 147 N° 12 907869..907997 129
N° 13 907723..907801 79 N° 14 907564..907673 110  
complement(join(907564..907673,907723..907801,907869..907997,908053..908199,9083 40..908582,908651..908753,908806..908921,908974..909066,909118..909504,909569..9 09982,910137..910250,910368..910416,910472..910634,910785..911343))


exon

Literature and cross-references SmRboh05-1_24 (SmRboh05a_24)
DNA ref. Phytozome 11:   scaffold_24 (911343..907564)
mRNA ref. JGI transcript:   101139
Protein sequence: SmRboh05-1_24 (SmRboh05a_24)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   901
PWM (Da):   %s   102728.05 Transmb domain:   %s   o351-370i490-512o532-554i716-733o
PI (pH):   %s   9.68
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDYHQVSLPPIQLQINDFNQPKEGEYHQLVELTLDVRKDSVTLRSIAPIPAQSAQAADPHGNTLLLDTRSNSNSKRASPQETAALIKSASAKLSKFTGDVWSHVRQLSSRSGKKAKDQEVVAPSSRGADIRRLARSKSGAEHALQGLRFISKSNNQKLAWELVSRRFDKLASEEGFIDKSDFGLCIGMEDSNEFAAELFDALARRRGLKQLRKLSKRDMYDFWLQISDQSFDARMQIFFDMCDKNLDGRISEREVKVIMLSASANRLSKLKEQAEEYAALIMEELDPENLGYIELWQLETLLMRGPHPKDHSSQQANQIITSTKAPGISRRLQRFLRNSRHSLGDNWRRMWVVSLWIMAMAGLFSWKFVQYKNKAAFQVMGYCVCTAKGAAETLKLNMALILFPVCRKTITWLRSTWLGNLVPFDDDINFHKIIALGIVVGVLIHAGTHLACDFVRIVNYPDQEFVRMIGKGFHNKKPTYVDILRSVEGVTGIIMVVLMVIAFTLASRWFRRDLIKLPWPLKNITGFNAFWYSHHLLIVVYILLLVHSFFLFLTYKWHEKNTWMYLAVPLLLYAGERAYRACRANYTVQIIKAAIYPGNVLALHMSKPPGFTYHSGMYLFLKCAEISPFEWHPFSITSAPGEDFLSVHIRTLGDWTQKMRKLFSVCEPSTDSKSGLLREELTTEEIPTSLGKFPKLVIDGPYGGPSQDYRKYDVLLLIGLGIGATPFISILKDMLNQRKMADQLQSPRRHSLESPRRRKRKCPTNAYFYWVTREQGSFEWFKGVMNEVAEIDHKAVIEMHNYLTSVYEEGDARSALIAMVQALHHAKNGVDIVSGTRVRTHFARPNWSKVFSNLSTTHANSTIGVFYCGPALLAKELRTLSQEYTQQSSCRFEFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (13 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACTACCACCAGGTGTCTCTGCCCCCAATCCAGCTCCAGATCAACGATTTCAATCAGCCGAAAGAGGGCGAGTATCACCAACTCGTGGAGCTGACGCTGGATGTGAGGAAGGATTCA
GTGACCCTCCGGAGCATCGCACCGATTCCAGCGCAGAGCGCCCAAGCGGCTGATCCTCACGGCAATACTCTGCTGCTCGACACACGATCTAATTCCAATTCCAAGAGGGCATCGCCACAG
GAGACGGCAGCGCTGATCAAGAGCGCGTCCGCCAAGCTCAGCAAATTCACAGGGGATGTGTGGAGCCATGTCCGGCAATTGTCGTCGCGGTCGGGGAAGAAGGCCAAGGATCAGGAGGTG
GTGGCGCCGAGCAGCCGTGGCGCGGACATCCGCAGGCTGGCGAGATCCAAATCGGGGGCCGAGCACGCATTGCAGGGGCTGCGATTCATCAGCAAGAGCAACAACCAGAAGCTGGCGTGG
GAATTGGTGTCGCGGCGATTCGACAAGCTCGCCAGCGAAGAGGGCTTCATCGACAAATCGGATTTTGGGCTGTGCATTG
GTAATGTTTCCCTTTCCAAGATCTTTCTCTCTCTCTCTCTC
TCTCTCTCTCTCCTTTAGCCATGAGAAAAGATCCAAGCAACACTTTCCTACCGTTTGGTTTTGATCGCTCGAAGGAACACCACTGATCTGCTTGGCCTCTGATCGACAGGAATGGAGGAT
TCCAACGAATTTGCCGCGGAGCTCTTCGATGCTCTGGCGCGGAGGCGAGGGCTCAAGCAGCTCAGGAAGCTGTCGAAGAGGGACATGTACGATTTCTGGTTGCAAATCTCTGATCAGAGC
TTCGATGCGAGGATGCAGATCTTCTTCGACAT
GTAAGTCAGTCCCGCTCGTAATCATGTAATTAGCAGCTGATCCGCCGCCTCATAGGTGTGACAAGAACCTCGATGGACGGATTTCAGA
GAGGGAGGTGAAAGAG
GTATGCATTTTTACAAACCTTTTGAAACTTCAAAAAGTTTCCAGATTTTGTTTCTTTCTCCTCTTTTTCTTTTTGCATATCCAGAAGAGAATTGCTGAACACTT
GCAATGGTGGCAGGTGATAATGCTGAGTGCGTCCGCCAACCGGCTGTCGAAACTCAAGGAGCAGGCCGAGGAATATGCCGCGCTCATCATGGAAGAACTGGATCCGGAAAACCTGGGCTA
CATCGAG
GTAGGAAATGAAGATTTAGACGTGGGAACAGAAAAGAAAGCAAAGAAGAAGCTTCGGATGGGAATCTAAAGTGTTCCAATCCGTCACAAGTATCTCAACGTTTTTTCTGACAC
CACCTTTTTGGTGCTTTTGGTTTGCATTCCATGGTTTGCAGCTATGGCAACTAGAGACGCTGCTGATGCGAGGACCACACCCCAAGGATCACAGCAGCCAGCAGGCGAACCAGATCATCA
CGAGCACGAAAGCACCAGGCATCTCACGCCGATTGCAGAGATTCCTGAGGAACTCGCGGCATTCTTTGGGTGATAACTGGAGGCGAATGTGGGTGGTGTCGCTGTGGATTATGGCCATGG
CCGGGCTCTTCAGCTGGAAGTTTGTGCAGTACAAGAACAAGGCGGCGTTCCAAGTCATGGGCTACTGCGTTTGTACCGCCAAGGGTGCTGCCGAGACGCTCAAGCTCAACATGGCTTTGA
TCCTCTTCCCGGTTTGCAGGAAGACGATCACCTGGCTTCGATCGACTTGGCTCGGGAATCTTGTTCCTTTTGACGATGATATCAACTTCCACAAG
GTAAGATCACCTTCGAGAAAGTTGT
ATACCAACTTGGCCGTCAACGTTTTTGTATACTTTGCAGATCATTGCTCTAGGGATTGTTGTGGGGGTTCTCATCCACGCAGGAACTCACCTGGCTTGCGATTTCGTTAGGATTGTCAAC
TATCCTGACCAGGAGTTTGTAAGGATGATCGGGAAAGGATTCCACAACAAGAAGCCAACTTATGTGGACATTCTTCGATCGGTGGAAGGGGTGACGGGAATTATCATGGTAGTATTGATG
GTCATCGCCTTCACTCTCGCGTCGAGATGGTTCCGGAGAGATCTCATCAAACTTCCCTGGCCTCTCAAAAACATTACCGGTTTCAATGCGTTTTGGTACTCGCATCACCTCCTCATCGTC
GTTTACATCCTCCTCCTCGTCCATTCCTTCTTCCTCTTCCTTACTTACAAGTGGCACGAAAAAAAT
GTAAGCTAAAACTCCTTTTTATCTTTTTCATAGCAGAATTTTGAATTGCAGACA
TGGATGTATTTGGCTGTGCCCCTACTGCTGTATGCTGGAGAGCGAGCGTATCGAGCTTGCAGGGCCAATTACACTGTACAAATCATCAAG
GTAAGCAAGGTTTTTGGAAAGATTTTGGCT
TTTTCTTATGATAGTCGAAAAGGCTGCGATATACCCCGGAAATGTGCTAGCTTTACACATGAGCAAGCCTCCTGGATTCACTTACCACAGTGGAATGTATCTCTTCCTCAAGTGCGCTGA
AATCTCGCCCTTCGAATG
GTATGGTGCAAATTATGGTTCTTGCCTTTGAAGCTTATAATGTTTTCCACAGGCATCCCTTCTCCATAACCTCCGCTCCAGGAGAGGATTTCCTGAGCGTTC
ACATCAGAACTTTGGGCGACTGGACGCAAAAGATGAGGAAGCTCTTCTCTGAG
GTACAATTTGTTTCCAATGATATGGTTTGCCAACTTTCTTATTTGATCATTTTATTCTTGTTACAAA
GGTTTGCGAGCCATCCACAGACAGCAAGAGCGGATTGTTAAGGGAGGAACTAACCACGGAAGAGATCCCAACCTCGCTAGGCAAATTCCCAAAGCTGGTGATAGACGGCCCGTATGGAGG
TCCTTCGCAAGACTATAGAAAGTACGATGTTCTTCTCCTCATTGGACTGGGAATCGGTGCCACTCCCTTTATCAGCATTCTCAAAGACATGCTCAACCAGCGCAAGATGGCCGATCAGCT
GCAA
GTAAGTGCGCTCAAGCCTCTTCAAACGATCTCTCGTGAGTAACAAAAGCTAGGCTCGATCGATTGTGCTTGCAGGATTTATCATTCTCGATTGATATGAGCAAGTCATTTGGATCT
CCCAACGGAGCACTAGCGCTGGAGAGCCCCAGGAGACACTCGCTCGAAAGCCCACGTAGACGCAAGCGGAAGTGTCCCACAAACGCGTATTTCTACTGGGTGACGCGGGAGCAGGGATCG
TTCGAGTGGTTTAAAGGTGTCATGAATGAAGTTGCGGAAATCGATCACAAG
GTAAAACCTCTCTATGTTCCTCCAAAGTTTGGATTATCAATCTTTTGTTTATCAGGCCGTGATTGAGAT
GCACAACTATCTCACGAGTGTTTATGAGGAGGGTGACGCGAGGTCTGCTCTCATTGCAATGGTTCAAGCATTGCACCATGCAAAAAACGGAGTTGACATTGTTTCTGGAACTCGG
GTATG
AATTTTGGGTATTTTCTTATGGTTTTTCTGAGTAATAATATCAATCGTATATAAACTTCCAGGTACGCACACATTTTGCTCGTCCAAACTGGAGCAAAGTTTTCTCAAACCTTTCGACGA
CGCATGCTAACTCCACAATTG
GTCAGTCAAATTGGTTTTCACTTTCCATATAGCTTTTTGATATTCGCAGGTGTTTTTTACTGCGGCCCGGCGCTGCTAGCAAAAGAGCTACGCACACTT
TCACAGGAATACACACAGCAATCAAGCTGCAGGTTTGAGTTTCACAAAGAAAACTTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACTACCACCAGGTGTCTCTGCCCCCAATCCAGCTCCAGATCAACGATTTCAATCAGCCGAAAGAGGGCGAGTATCACCAACTCGTGGAGCTGACGCTGGATGTGAGGAAGGATTCA
GTGACCCTCCGGAGCATCGCACCGATTCCAGCGCAGAGCGCCCAAGCGGCTGATCCTCACGGCAATACTCTGCTGCTCGACACACGATCTAATTCCAATTCCAAGAGGGCATCGCCACAG
GAGACGGCAGCGCTGATCAAGAGCGCGTCCGCCAAGCTCAGCAAATTCACAGGGGATGTGTGGAGCCATGTCCGGCAATTGTCGTCGCGGTCGGGGAAGAAGGCCAAGGATCAGGAGGTG
GTGGCGCCGAGCAGCCGTGGCGCGGACATCCGCAGGCTGGCGAGATCCAAATCGGGGGCCGAGCACGCATTGCAGGGGCTGCGATTCATCAGCAAGAGCAACAACCAGAAGCTGGCGTGG
GAATTGGTGTCGCGGCGATTCGACAAGCTCGCCAGCGAAGAGGGCTTCATCGACAAATCGGATTTTGGGCTGTGCATTG
GAATGGAGGATTCCAACGAATTTGCCGCGGAGCTCTTCGAT
GCTCTGGCGCGGAGGCGAGGGCTCAAGCAGCTCAGGAAGCTGTCGAAGAGGGACATGTACGATTTCTGGTTGCAAATCTCTGATCAGAGCTTCGATGCGAGGATGCAGATCTTCTTCGAC
AT
GTGTGACAAGAACCTCGATGGACGGATTTCAGAGAGGGAGGTGAAAGAGGTGATAATGCTGAGTGCGTCCGCCAACCGGCTGTCGAAACTCAAGGAGCAGGCCGAGGAATATGCCGCG
CTCATCATGGAAGAACTGGATCCGGAAAACCTGGGCTACATCGAG
CTATGGCAACTAGAGACGCTGCTGATGCGAGGACCACACCCCAAGGATCACAGCAGCCAGCAGGCGAACCAGATC
ATCACGAGCACGAAAGCACCAGGCATCTCACGCCGATTGCAGAGATTCCTGAGGAACTCGCGGCATTCTTTGGGTGATAACTGGAGGCGAATGTGGGTGGTGTCGCTGTGGATTATGGCC
ATGGCCGGGCTCTTCAGCTGGAAGTTTGTGCAGTACAAGAACAAGGCGGCGTTCCAAGTCATGGGCTACTGCGTTTGTACCGCCAAGGGTGCTGCCGAGACGCTCAAGCTCAACATGGCT
TTGATCCTCTTCCCGGTTTGCAGGAAGACGATCACCTGGCTTCGATCGACTTGGCTCGGGAATCTTGTTCCTTTTGACGATGATATCAACTTCCACAAG
ATCATTGCTCTAGGGATTGTT
GTGGGGGTTCTCATCCACGCAGGAACTCACCTGGCTTGCGATTTCGTTAGGATTGTCAACTATCCTGACCAGGAGTTTGTAAGGATGATCGGGAAAGGATTCCACAACAAGAAGCCAACT
TATGTGGACATTCTTCGATCGGTGGAAGGGGTGACGGGAATTATCATGGTAGTATTGATGGTCATCGCCTTCACTCTCGCGTCGAGATGGTTCCGGAGAGATCTCATCAAACTTCCCTGG
CCTCTCAAAAACATTACCGGTTTCAATGCGTTTTGGTACTCGCATCACCTCCTCATCGTCGTTTACATCCTCCTCCTCGTCCATTCCTTCTTCCTCTTCCTTACTTACAAGTGGCACGAA
AAAAAT
ACATGGATGTATTTGGCTGTGCCCCTACTGCTGTATGCTGGAGAGCGAGCGTATCGAGCTTGCAGGGCCAATTACACTGTACAAATCATCAAGGCTGCGATATACCCCGGAAAT
GTGCTAGCTTTACACATGAGCAAGCCTCCTGGATTCACTTACCACAGTGGAATGTATCTCTTCCTCAAGTGCGCTGAAATCTCGCCCTTCGAATG
GCATCCCTTCTCCATAACCTCCGCT
CCAGGAGAGGATTTCCTGAGCGTTCACATCAGAACTTTGGGCGACTGGACGCAAAAGATGAGGAAGCTCTTCTCTGAG
GTTTGCGAGCCATCCACAGACAGCAAGAGCGGATTGTTAAGG
GAGGAACTAACCACGGAAGAGATCCCAACCTCGCTAGGCAAATTCCCAAAGCTGGTGATAGACGGCCCGTATGGAGGTCCTTCGCAAGACTATAGAAAGTACGATGTTCTTCTCCTCATT
GGACTGGGAATCGGTGCCACTCCCTTTATCAGCATTCTCAAAGACATGCTCAACCAGCGCAAGATGGCCGATCAGCTGCAA
AGCCCCAGGAGACACTCGCTCGAAAGCCCACGTAGACGC
AAGCGGAAGTGTCCCACAAACGCGTATTTCTACTGGGTGACGCGGGAGCAGGGATCGTTCGAGTGGTTTAAAGGTGTCATGAATGAAGTTGCGGAAATCGATCACAAG
GCCGTGATTGAG
ATGCACAACTATCTCACGAGTGTTTATGAGGAGGGTGACGCGAGGTCTGCTCTCATTGCAATGGTTCAAGCATTGCACCATGCAAAAAACGGAGTTGACATTGTTTCTGGAACTCGG
GTA
CGCACACATTTTGCTCGTCCAAACTGGAGCAAAGTTTTCTCAAACCTTTCGACGACGCATGCTAACTCCACAATTG
GTGTTTTTTACTGCGGCCCGGCGCTGCTAGCAAAAGAGCTACGC
ACACTTTCACAGGAATACACACAGCAATCAAGCTGCAGGTTTGAGTTTCACAAAGAAAACTTCTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACTACC ACCAGGTGTC TCTGCCCCCA ATCCAGCTCC AGATCAACGA TTTCAATCAG CCGAAAGAGG GCGAGTATCA CCAACTCGTG GAGCTGACGC TGGATGTGAG GAAGGATTCA  GTGACCCTCC GGAGCATCGC ACCGATTCCA GCGCAGAGCG CCCAAGCGGC TGATCCTCAC GGCAATACTC TGCTGCTCGA CACACGATCT AATTCCAATT CCAAGAGGGC ATCGCCACAG  GAGACGGCAG CGCTGATCAA GAGCGCGTCC GCCAAGCTCA GCAAATTCAC AGGGGATGTG TGGAGCCATG TCCGGCAATT GTCGTCGCGG TCGGGGAAGA AGGCCAAGGA TCAGGAGGTG  GTGGCGCCGA GCAGCCGTGG CGCGGACATC CGCAGGCTGG CGAGATCCAA ATCGGGGGCC GAGCACGCAT TGCAGGGGCT GCGATTCATC AGCAAGAGCA ACAACCAGAA GCTGGCGTGG  GAATTGGTGT CGCGGCGATT CGACAAGCTC GCCAGCGAAG AGGGCTTCAT CGACAAATCG GATTTTGGGC TGTGCATTGG AATGGAGGAT TCCAACGAAT TTGCCGCGGA GCTCTTCGAT  GCTCTGGCGC GGAGGCGAGG GCTCAAGCAG CTCAGGAAGC TGTCGAAGAG GGACATGTAC GATTTCTGGT TGCAAATCTC TGATCAGAGC TTCGATGCGA GGATGCAGAT CTTCTTCGAC  ATGTGTGACA AGAACCTCGA TGGACGGATT TCAGAGAGGG AGGTGAAAGA GGTGATAATG CTGAGTGCGT CCGCCAACCG GCTGTCGAAA CTCAAGGAGC AGGCCGAGGA ATATGCCGCG  CTCATCATGG AAGAACTGGA TCCGGAAAAC CTGGGCTACA TCGAGCTATG GCAACTAGAG ACGCTGCTGA TGCGAGGACC ACACCCCAAG GATCACAGCA GCCAGCAGGC GAACCAGATC  ATCACGAGCA CGAAAGCACC AGGCATCTCA CGCCGATTGC AGAGATTCCT GAGGAACTCG CGGCATTCTT TGGGTGATAA CTGGAGGCGA ATGTGGGTGG TGTCGCTGTG GATTATGGCC  ATGGCCGGGC TCTTCAGCTG GAAGTTTGTG CAGTACAAGA ACAAGGCGGC GTTCCAAGTC ATGGGCTACT GCGTTTGTAC CGCCAAGGGT GCTGCCGAGA CGCTCAAGCT CAACATGGCT  TTGATCCTCT TCCCGGTTTG CAGGAAGACG ATCACCTGGC TTCGATCGAC TTGGCTCGGG AATCTTGTTC CTTTTGACGA TGATATCAAC TTCCACAAGA TCATTGCTCT AGGGATTGTT  GTGGGGGTTC TCATCCACGC AGGAACTCAC CTGGCTTGCG ATTTCGTTAG GATTGTCAAC TATCCTGACC AGGAGTTTGT AAGGATGATC GGGAAAGGAT TCCACAACAA GAAGCCAACT  TATGTGGACA TTCTTCGATC GGTGGAAGGG GTGACGGGAA TTATCATGGT AGTATTGATG GTCATCGCCT TCACTCTCGC GTCGAGATGG TTCCGGAGAG ATCTCATCAA ACTTCCCTGG  CCTCTCAAAA ACATTACCGG TTTCAATGCG TTTTGGTACT CGCATCACCT CCTCATCGTC GTTTACATCC TCCTCCTCGT CCATTCCTTC TTCCTCTTCC TTACTTACAA GTGGCACGAA  AAAAATACAT GGATGTATTT GGCTGTGCCC CTACTGCTGT ATGCTGGAGA GCGAGCGTAT CGAGCTTGCA GGGCCAATTA CACTGTACAA ATCATCAAGG CTGCGATATA CCCCGGAAAT  GTGCTAGCTT TACACATGAG CAAGCCTCCT GGATTCACTT ACCACAGTGG AATGTATCTC TTCCTCAAGT GCGCTGAAAT CTCGCCCTTC GAATGGCATC CCTTCTCCAT AACCTCCGCT  CCAGGAGAGG ATTTCCTGAG CGTTCACATC AGAACTTTGG GCGACTGGAC GCAAAAGATG AGGAAGCTCT TCTCTGAGGT TTGCGAGCCA TCCACAGACA GCAAGAGCGG ATTGTTAAGG  GAGGAACTAA CCACGGAAGA GATCCCAACC TCGCTAGGCA AATTCCCAAA GCTGGTGATA GACGGCCCGT ATGGAGGTCC TTCGCAAGAC TATAGAAAGT ACGATGTTCT TCTCCTCATT  GGACTGGGAA TCGGTGCCAC TCCCTTTATC AGCATTCTCA AAGACATGCT CAACCAGCGC AAGATGGCCG ATCAGCTGCA AAGCCCCAGG AGACACTCGC TCGAAAGCCC ACGTAGACGC  AAGCGGAAGT GTCCCACAAA CGCGTATTTC TACTGGGTGA CGCGGGAGCA GGGATCGTTC GAGTGGTTTA AAGGTGTCAT GAATGAAGTT GCGGAAATCG ATCACAAGGC CGTGATTGAG  ATGCACAACT ATCTCACGAG TGTTTATGAG GAGGGTGACG CGAGGTCTGC TCTCATTGCA ATGGTTCAAG CATTGCACCA TGCAAAAAAC GGAGTTGACA TTGTTTCTGG AACTCGGGTA  CGCACACATT TTGCTCGTCC AAACTGGAGC AAAGTTTTCT CAAACCTTTC GACGACGCAT GCTAACTCCA CAATTGGTGT TTTTTACTGC GGCCCGGCGC TGCTAGCAAA AGAGCTACGC 
ACACTTTCAC AGGAATACAC ACAGCAATCA AGCTGCAGGT TTGAGTTTCA CAAAGAAAAC TTCTAG 

Retrieve as FASTA