Entry information : SmRboh05-2_69 (SmRboh05b_69)
Entry ID 7389
Creation 0000-00-00 (Christophe Dunand)
Last sequence changes 2010-06-01 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmRboh05-2_69 (SmRboh05b_69)
Name (synonym) SmRboh05-2_69 (SmRboh05b_69)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmRboh05-2_69
start..stop
S start..stop
SmRboh05-1_24 1831 0 1..902 1..901
SmRboh02-2_137 1164 0 27..902 62..902
SmRboh02-1_19 1162 0 27..902 55..895
CsRboh01 1041 0 28..902 37..946
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 458078..458639 562 N° 2 457776..457938 163 N° 3 457672..457720 49 N° 4 457428..457541 114
N° 5 456860..457273 414 N° 6 456409..456795 387 N° 7 456265..456357 93 N° 8 456097..456212 116
N° 9 455942..456044 103 N° 10 455631..455873 243 N° 11 455344..455490 147 N° 12 455160..455288 129
N° 13 455014..455092 79 N° 14 454855..454964 110  
complement(join(454855..454964,455014..455092,455160..455288,455344..455490,4556 31..455873,455942..456044,456097..456212,456265..456357,456409..456795,456860..4 57273,457428..457541,457672..457720,457776..457938,458078..458639))


exon

Literature and cross-references SmRboh05-2_69 (SmRboh05b_69)
DNA ref. Phytozome 11:   scaffold_69 (458639..454855)
mRNA ref. JGI transcript:   122844
Protein sequence: SmRboh05-2_69 (SmRboh05b_69)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   902
PWM (Da):   %s   103081.16 Transmb domain:   %s   o352-371i491-513o533-555i717-734o
PI (pH):   %s   9.87
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDYHQVSLPPIQLQINDFNQPKEGEYHQLVELTLDVRKDSVTLRSIAPVPAQSAQAADPHGNTLLLDTRSNSNSKRASPQATAALIKSASAKLSKFTGDVWSHVRQLSSRSGKKAKDQEVVAPSSRGADIRRLARSKSGAEHALQGLRFISKSNNQKLAWELVSRRFDKLASEEGFIDKSDFGLCIGRMEDSNEFAAELFDALARRRGLKQLRKLSKRDMYDFWLQISDQSFDARMQIFFDMCDKNLDGRISEREVKVIMLSASANRLSKLKEQAEEYAALIMEELDPENLGYIELWQLETLLMRGPHPKDHSSQQASQIITSTKAPGISRRLQRFLRNSRHSLGDNWRRMWVVSLWIMAMAGLFSWKFVQYKNKAAFQVMGYCVCTAKGAAETLKLNMALILFPVCRKTITWLRSTWLGNLVPFDDDINFHKIIALGIVVGVFIHAGTHLACDFVRIVNYPDQEFVRMIGKGFHNKKPTYVDILRSVEGVTGIMMVVLMVIAFTLASRWFRRDLIKLPWPLKNMTGFNAFWYSHHLLIVVYILLLVHSFFLFLTYKWHEKNTWMYLAVPLLLYAGERVYRACRANYTVQIIKAAIYPGNVLALHMSKPPGFTYHSGMYLFLKCAEVSPFEWHPFSITSAPGEDFLSVHIRTLGDWTQKMRKLFSVCEPSTDNKSRLLREERTTEEIPTSRGKFPKLVIDGPYGGPSQDYRKYDVLLLIGLGIGATPFISILKDMLNQRKMADQLQSPRRHSLESPRRRKRKCPTNAYFYWVTREQGSFEWFKGVMNEVAEIDHKAVIEMHNYLTSVYEEGDARSALIAMVQALHHAKNGVDIVSGTRVRTHFARPNWSKVFSNLSTTHANSTIGVFYCGPALLAKELRTLSQEYTQQSSCRFEFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (13 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACTACCACCAGGTGTCTCTGCCCCCAATCCAGCTCCAGATCAACGATTTCAATCAGCCGAAAGAGGGCGAGTATCACCAACTCGTGGAGCTGACGCTGGATGTGAGGAAGGATTCA
GTGACCCTCCGCAGCATCGCACCGGTTCCAGCGCAGAGCGCCCAAGCGGCTGATCCTCACGGCAATACTCTGCTGCTCGACACGCGATCCAATTCCAATTCCAAGAGGGCATCGCCACAG
GCGACGGCAGCGCTGATCAAGAGCGCGTCCGCCAAGCTCAGCAAATTCACAGGAGATGTGTGGAGCCATGTCCGGCAATTGTCGTCGCGGTCGGGGAAGAAGGCCAAGGATCAGGAGGTG
GTGGCGCCGAGCAGCCGTGGCGCGGACATCCGCAGGCTGGCGAGATCCAAATCGGGGGCCGAGCACGCATTGCAGGGGCTGCGATTCATCAGCAAGAGCAACAACCAGAAGCTGGCGTGG
GAATTGGTGTCACGGCGATTCGACAAGCTCGCCAGCGAAGAGGGCTTCATCGACAAATCGGATTTTGGGCTGTGCATTGGTA
GTGTTTCCCTTTCCAAGATCTTTCTCTTTCTCTCTCTC
TCTCCTTTAGCCATGAGAAAAGATCCAAGCAACACTTTCCTACCGTTTGGTTTTGATCGCTCGAAGGAACACCACTGATCTGCTTGGCCTCTGATCGACAGGAATGGAGGATTCCAACGA
ATTTGCCGCGGAGCTCTTCGATGCTCTGGCACGGAGGCGAGGGCTCAAGCAGCTCAGGAAGCTGTCGAAGAGGGACATGTACGATTTCTGGTTGCAAATCTCTGATCAGAGCTTCGATGC
GAGGATGCAGATCTTCTTCGACAT
GTAAGTCAGCCCCGCTCGTAATCATGTAATTAGCAGCTGATCCGCCGCCTCATAGGTGTGACAAGAACCTCGATGGACGGATTTCAGAGAGGGAGG
TGAAAGAG
GTATGCATTTTTACAAACCTTTTGAAACTTCAAAAAGTTTCCAGATTTTGTTTCTTTCTCCTCTTTTTCTGTTTGTGAGAGGAAGAAGCATATCCAGAAGAGAATTGCTGAA
CACTTGCAATGGTGGCAGGTGATAATGCTGAGTGCGTCCGCCAACCGGCTGTCGAAACTCAAGGAGCAGGCCGAGGAATATGCCGCGCTCATCATGGAAGAACTGGATCCGGAAAACCTG
GGCTACATCGAG
GTAGGAAATGAAGATTTAGACGTGGGAACAGAAAAGAAAGCAAAGAAGAAGCTTCGGATGGGAATCTAAAGTGTTCCAATCCGTCACAAGTATCTCAACGTTTTTTCT
GACACCACCTTTTTGGTGCTTTTGGTTTGCATTGCATGGTTTGCAGCTATGGCAACTAGAGACGCTGCTGATGCGAGGACCACACCCCAAGGATCACAGCAGCCAGCAGGCGAGCCAGAT
CATCACGAGCACGAAAGCACCAGGCATCTCACGCCGATTGCAGAGATTCCTGAGGAACTCGCGGCATTCTTTGGGTGATAACTGGAGGCGAATGTGGGTGGTGTCGCTGTGGATTATGGC
CATGGCCGGGCTCTTCAGCTGGAAGTTTGTGCAGTACAAGAACAAGGCGGCGTTCCAAGTCATGGGCTACTGCGTTTGCACCGCCAAGGGTGCTGCCGAGACGCTCAAGCTCAACATGGC
TTTGATCCTCTTCCCGGTTTGCAGGAAGACGATCACCTGGCTTCGATCGACTTGGCTCGGGAATCTTGTTCCTTTTGACGATGATATCAACTTCCACAAG
GTAAGATCACCTTCGAGAAA
GTTGTATACCAACTTGGCCATCAACGTTTTTGTATACTTTGCAGATCATTGCTCTAGGGATTGTTGTGGGGGTTTTCATCCACGCAGGAACTCACCTGGCTTGCGATTTCGTTAGGATTG
TCAACTATCCTGACCAGGAGTTTGTAAGGATGATCGGGAAAGGATTCCACAACAAGAAACCAACTTATGTGGACATTCTTCGATCGGTGGAAGGGGTGACGGGAATTATGATGGTAGTAT
TGATGGTCATCGCCTTCACTCTCGCGTCGAGATGGTTCCGGAGAGATCTCATCAAACTTCCCTGGCCTCTCAAGAACATGACCGGTTTCAATGCGTTTTGGTACTCGCATCACCTCCTCA
TCGTCGTTTACATCCTCCTCCTCGTCCATTCCTTCTTCCTCTTCCTTACTTACAAGTGGCACGAAAAAAAT
GTAAGACAAAACTCCTTTTTATCTTTTTCAAAGCAGAATTTTGAATTGC
AGACATGGATGTATTTGGCTGTGCCCCTACTGCTGTATGCTGGAGAGCGAGTGTATCGAGCTTGCAGGGCCAATTACACTGTACAAATCATCAAGGTAAGCAAGGTTTTTGGAAAGATTT
GGGCTTTTTCTTATGATAGTCGAAAAGGCTGCGATATACCCCGGAAATGTGCTAGCTTTACACATGAGCAAGCCTCCTGGATTCACTTACCACAGTGGAATGTATCTCTTCCTCAAGTGC
GCTGAAGTCTCGCCCTTCGAATG
GTATGATGCAAATTATGGTTCTTGCCTTTGGAGCTTATATTTTTTTCCACAGGCATCCCTTCTCCATAACCTCCGCTCCAGGAGAGGATTTCCTGAG
CGTTCACATCAGAACTTTGGGCGACTGGACGCAAAAGATGAGAAAGCTCTTCTCTGAG
GTACAATTTGTTTCCAATCATATGGTTTGCTAACGTTCTTATTTGATCATTTTATTCTTGTT
ACAAAGGTTTGCGAGCCATCCACAGACAACAAGAGCAGATTGCTAAGGGAGGAACGAACCACGGAAGAGATCCCAACCTCGCGAGGCAAATTCCCAAAGCTGGTGATTGACGGCCCGTAT
GGAGGTCCTTCGCAAGACTATAGAAAGTACGATGTTCTTCTCCTCATTGGACTGGGAATCGGTGCCACTCCTTTTATCAGCATTCTCAAAGACATGCTCAACCAGCGCAAGATGGCCGAC
CAGCTCCAA
GTAAGTGCGCTCAAGCCTCTTCAAACGATCTCTCGTGAGTAACAAAGGCTAGGCTCGATCGATTGTGCTTGCAGGATTTATCATTCTCGATTGATATGAGCAAGTCATTTG
GATCTCCCAACGGAGCACTAGCGCTGGAGAGCCCCAGGAGACACTCGCTCGAAAGCCCACGTAGACGCAAGCGGAAGTGTCCCACAAACGCGTATTTCTACTGGGTGACGCGGGAGCAGG
GATCGTTCGAGTGGTTTAAAGGTGTCATGAATGAAGTTGCGGAAATCGATCACAAG
GTAAAACCTCTCTATGTTCCTCCAAAGTTTGGATTATCAATCTTTTGTTTATCAGGCCGTGATT
GAGATGCACAACTATCTCACGAGTGTTTATGAGGAGGGTGACGCGAGGTCTGCTCTCATTGCAATGGTTCAAGCTTTGCACCATGCAAAAAACGGAGTTGACATTGTTTCTGGAACTCGG
GTATGAATTCTGGGTATTTTCTTATGGTTTTTCTGAGTAATAATATCAATCGTATATAAACTTCCAGGTACGCACACATTTTGCTCGTCCAAACTGGAGCAAAGTTTTCTCAAACCTTTC
AACGACGCATGCTAACTCCACAATTG
GTCAGTCAAATTGGTTTTCACTTTCCATATAACTTTTTGATATTCGCAGGTGTTTTTTACTGCGGGCCGGCGCTCCTAGCAAAAGAGCTACGCA
CACTTTCACAGGAATACACACAGCAATCAAGCTGCAGGTTTGAGTTTCACAAAGAAAACTTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACTACCACCAGGTGTCTCTGCCCCCAATCCAGCTCCAGATCAACGATTTCAATCAGCCGAAAGAGGGCGAGTATCACCAACTCGTGGAGCTGACGCTGGATGTGAGGAAGGATTCA
GTGACCCTCCGCAGCATCGCACCGGTTCCAGCGCAGAGCGCCCAAGCGGCTGATCCTCACGGCAATACTCTGCTGCTCGACACGCGATCCAATTCCAATTCCAAGAGGGCATCGCCACAG
GCGACGGCAGCGCTGATCAAGAGCGCGTCCGCCAAGCTCAGCAAATTCACAGGAGATGTGTGGAGCCATGTCCGGCAATTGTCGTCGCGGTCGGGGAAGAAGGCCAAGGATCAGGAGGTG
GTGGCGCCGAGCAGCCGTGGCGCGGACATCCGCAGGCTGGCGAGATCCAAATCGGGGGCCGAGCACGCATTGCAGGGGCTGCGATTCATCAGCAAGAGCAACAACCAGAAGCTGGCGTGG
GAATTGGTGTCACGGCGATTCGACAAGCTCGCCAGCGAAGAGGGCTTCATCGACAAATCGGATTTTGGGCTGTGCATTGGTA
GAATGGAGGATTCCAACGAATTTGCCGCGGAGCTCTTC
GATGCTCTGGCACGGAGGCGAGGGCTCAAGCAGCTCAGGAAGCTGTCGAAGAGGGACATGTACGATTTCTGGTTGCAAATCTCTGATCAGAGCTTCGATGCGAGGATGCAGATCTTCTTC
GACAT
GTGTGACAAGAACCTCGATGGACGGATTTCAGAGAGGGAGGTGAAAGAGGTGATAATGCTGAGTGCGTCCGCCAACCGGCTGTCGAAACTCAAGGAGCAGGCCGAGGAATATGCC
GCGCTCATCATGGAAGAACTGGATCCGGAAAACCTGGGCTACATCGAG
CTATGGCAACTAGAGACGCTGCTGATGCGAGGACCACACCCCAAGGATCACAGCAGCCAGCAGGCGAGCCAG
ATCATCACGAGCACGAAAGCACCAGGCATCTCACGCCGATTGCAGAGATTCCTGAGGAACTCGCGGCATTCTTTGGGTGATAACTGGAGGCGAATGTGGGTGGTGTCGCTGTGGATTATG
GCCATGGCCGGGCTCTTCAGCTGGAAGTTTGTGCAGTACAAGAACAAGGCGGCGTTCCAAGTCATGGGCTACTGCGTTTGCACCGCCAAGGGTGCTGCCGAGACGCTCAAGCTCAACATG
GCTTTGATCCTCTTCCCGGTTTGCAGGAAGACGATCACCTGGCTTCGATCGACTTGGCTCGGGAATCTTGTTCCTTTTGACGATGATATCAACTTCCACAAG
ATCATTGCTCTAGGGATT
GTTGTGGGGGTTTTCATCCACGCAGGAACTCACCTGGCTTGCGATTTCGTTAGGATTGTCAACTATCCTGACCAGGAGTTTGTAAGGATGATCGGGAAAGGATTCCACAACAAGAAACCA
ACTTATGTGGACATTCTTCGATCGGTGGAAGGGGTGACGGGAATTATGATGGTAGTATTGATGGTCATCGCCTTCACTCTCGCGTCGAGATGGTTCCGGAGAGATCTCATCAAACTTCCC
TGGCCTCTCAAGAACATGACCGGTTTCAATGCGTTTTGGTACTCGCATCACCTCCTCATCGTCGTTTACATCCTCCTCCTCGTCCATTCCTTCTTCCTCTTCCTTACTTACAAGTGGCAC
GAAAAAAAT
ACATGGATGTATTTGGCTGTGCCCCTACTGCTGTATGCTGGAGAGCGAGTGTATCGAGCTTGCAGGGCCAATTACACTGTACAAATCATCAAGGCTGCGATATACCCCGGA
AATGTGCTAGCTTTACACATGAGCAAGCCTCCTGGATTCACTTACCACAGTGGAATGTATCTCTTCCTCAAGTGCGCTGAAGTCTCGCCCTTCGAATG
GCATCCCTTCTCCATAACCTCC
GCTCCAGGAGAGGATTTCCTGAGCGTTCACATCAGAACTTTGGGCGACTGGACGCAAAAGATGAGAAAGCTCTTCTCTGAG
GTTTGCGAGCCATCCACAGACAACAAGAGCAGATTGCTA
AGGGAGGAACGAACCACGGAAGAGATCCCAACCTCGCGAGGCAAATTCCCAAAGCTGGTGATTGACGGCCCGTATGGAGGTCCTTCGCAAGACTATAGAAAGTACGATGTTCTTCTCCTC
ATTGGACTGGGAATCGGTGCCACTCCTTTTATCAGCATTCTCAAAGACATGCTCAACCAGCGCAAGATGGCCGACCAGCTCCAA
AGCCCCAGGAGACACTCGCTCGAAAGCCCACGTAGA
CGCAAGCGGAAGTGTCCCACAAACGCGTATTTCTACTGGGTGACGCGGGAGCAGGGATCGTTCGAGTGGTTTAAAGGTGTCATGAATGAAGTTGCGGAAATCGATCACAAG
GCCGTGATT
GAGATGCACAACTATCTCACGAGTGTTTATGAGGAGGGTGACGCGAGGTCTGCTCTCATTGCAATGGTTCAAGCTTTGCACCATGCAAAAAACGGAGTTGACATTGTTTCTGGAACTCGG
GTACGCACACATTTTGCTCGTCCAAACTGGAGCAAAGTTTTCTCAAACCTTTCAACGACGCATGCTAACTCCACAATTGGTGTTTTTTACTGCGGGCCGGCGCTCCTAGCAAAAGAGCTA
CGCACACTTTCACAGGAATACACACAGCAATCAAGCTGCAGGTTTGAGTTTCACAAAGAAAACTTCTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACTACC ACCAGGTGTC TCTGCCCCCA ATCCAGCTCC AGATCAACGA TTTCAATCAG CCGAAAGAGG GCGAGTATCA CCAACTCGTG GAGCTGACGC TGGATGTGAG GAAGGATTCA  GTGACCCTCC GCAGCATCGC ACCGGTTCCA GCGCAGAGCG CCCAAGCGGC TGATCCTCAC GGCAATACTC TGCTGCTCGA CACGCGATCC AATTCCAATT CCAAGAGGGC ATCGCCACAG  GCGACGGCAG CGCTGATCAA GAGCGCGTCC GCCAAGCTCA GCAAATTCAC AGGAGATGTG TGGAGCCATG TCCGGCAATT GTCGTCGCGG TCGGGGAAGA AGGCCAAGGA TCAGGAGGTG  GTGGCGCCGA GCAGCCGTGG CGCGGACATC CGCAGGCTGG CGAGATCCAA ATCGGGGGCC GAGCACGCAT TGCAGGGGCT GCGATTCATC AGCAAGAGCA ACAACCAGAA GCTGGCGTGG  GAATTGGTGT CACGGCGATT CGACAAGCTC GCCAGCGAAG AGGGCTTCAT CGACAAATCG GATTTTGGGC TGTGCATTGG TAGAATGGAG GATTCCAACG AATTTGCCGC GGAGCTCTTC  GATGCTCTGG CACGGAGGCG AGGGCTCAAG CAGCTCAGGA AGCTGTCGAA GAGGGACATG TACGATTTCT GGTTGCAAAT CTCTGATCAG AGCTTCGATG CGAGGATGCA GATCTTCTTC  GACATGTGTG ACAAGAACCT CGATGGACGG ATTTCAGAGA GGGAGGTGAA AGAGGTGATA ATGCTGAGTG CGTCCGCCAA CCGGCTGTCG AAACTCAAGG AGCAGGCCGA GGAATATGCC  GCGCTCATCA TGGAAGAACT GGATCCGGAA AACCTGGGCT ACATCGAGCT ATGGCAACTA GAGACGCTGC TGATGCGAGG ACCACACCCC AAGGATCACA GCAGCCAGCA GGCGAGCCAG  ATCATCACGA GCACGAAAGC ACCAGGCATC TCACGCCGAT TGCAGAGATT CCTGAGGAAC TCGCGGCATT CTTTGGGTGA TAACTGGAGG CGAATGTGGG TGGTGTCGCT GTGGATTATG  GCCATGGCCG GGCTCTTCAG CTGGAAGTTT GTGCAGTACA AGAACAAGGC GGCGTTCCAA GTCATGGGCT ACTGCGTTTG CACCGCCAAG GGTGCTGCCG AGACGCTCAA GCTCAACATG  GCTTTGATCC TCTTCCCGGT TTGCAGGAAG ACGATCACCT GGCTTCGATC GACTTGGCTC GGGAATCTTG TTCCTTTTGA CGATGATATC AACTTCCACA AGATCATTGC TCTAGGGATT  GTTGTGGGGG TTTTCATCCA CGCAGGAACT CACCTGGCTT GCGATTTCGT TAGGATTGTC AACTATCCTG ACCAGGAGTT TGTAAGGATG ATCGGGAAAG GATTCCACAA CAAGAAACCA  ACTTATGTGG ACATTCTTCG ATCGGTGGAA GGGGTGACGG GAATTATGAT GGTAGTATTG ATGGTCATCG CCTTCACTCT CGCGTCGAGA TGGTTCCGGA GAGATCTCAT CAAACTTCCC  TGGCCTCTCA AGAACATGAC CGGTTTCAAT GCGTTTTGGT ACTCGCATCA CCTCCTCATC GTCGTTTACA TCCTCCTCCT CGTCCATTCC TTCTTCCTCT TCCTTACTTA CAAGTGGCAC  GAAAAAAATA CATGGATGTA TTTGGCTGTG CCCCTACTGC TGTATGCTGG AGAGCGAGTG TATCGAGCTT GCAGGGCCAA TTACACTGTA CAAATCATCA AGGCTGCGAT ATACCCCGGA  AATGTGCTAG CTTTACACAT GAGCAAGCCT CCTGGATTCA CTTACCACAG TGGAATGTAT CTCTTCCTCA AGTGCGCTGA AGTCTCGCCC TTCGAATGGC ATCCCTTCTC CATAACCTCC  GCTCCAGGAG AGGATTTCCT GAGCGTTCAC ATCAGAACTT TGGGCGACTG GACGCAAAAG ATGAGAAAGC TCTTCTCTGA GGTTTGCGAG CCATCCACAG ACAACAAGAG CAGATTGCTA  AGGGAGGAAC GAACCACGGA AGAGATCCCA ACCTCGCGAG GCAAATTCCC AAAGCTGGTG ATTGACGGCC CGTATGGAGG TCCTTCGCAA GACTATAGAA AGTACGATGT TCTTCTCCTC  ATTGGACTGG GAATCGGTGC CACTCCTTTT ATCAGCATTC TCAAAGACAT GCTCAACCAG CGCAAGATGG CCGACCAGCT CCAAAGCCCC AGGAGACACT CGCTCGAAAG CCCACGTAGA  CGCAAGCGGA AGTGTCCCAC AAACGCGTAT TTCTACTGGG TGACGCGGGA GCAGGGATCG TTCGAGTGGT TTAAAGGTGT CATGAATGAA GTTGCGGAAA TCGATCACAA GGCCGTGATT  GAGATGCACA ACTATCTCAC GAGTGTTTAT GAGGAGGGTG ACGCGAGGTC TGCTCTCATT GCAATGGTTC AAGCTTTGCA CCATGCAAAA AACGGAGTTG ACATTGTTTC TGGAACTCGG  GTACGCACAC ATTTTGCTCG TCCAAACTGG AGCAAAGTTT TCTCAAACCT TTCAACGACG CATGCTAACT CCACAATTGG TGTTTTTTAC TGCGGGCCGG CGCTCCTAGC AAAAGAGCTA 
CGCACACTTT CACAGGAATA CACACAGCAA TCAAGCTGCA GGTTTGAGTT TCACAAAGAA AACTTCTAG 

Retrieve as FASTA