Entry information : SmRboh06-1_0 (SmRboh06a_0)
Entry ID 7390
Creation 0000-00-00 (Christophe Dunand)
Last sequence changes 2010-06-01 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmRboh06-1_0 (SmRboh06a_0)
Name (synonym) SmRboh06-1_0 (SmRboh06a_0)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmRboh06-1_0
start..stop
S start..stop
SmRboh06-2_8 1425 0 1..711 67..756
SmRboh04-1_39 898 0 3..711 80..788
SmRboh04-2_88 896 0 3..711 80..789
SmRboh03-1_13 878 0 1..711 1..693
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3570486..3570673 188 N° 2 3570728..3570776 49 N° 3 3570831..3570944 114 N° 4 3571013..3571420 408
N° 5 3571480..3571866 387 N° 6 3571914..3572009 96 N° 7 3572066..3572181 116 N° 8 3572232..3572362 131
N° 9 3572441..3572769 329 N° 10 3572824..3572952 129 N° 11 3573022..3573210 189  
join(3570486..3570673,3570728..3570776,3570831..3570944,3571013..3571420,3571480 ..3571866,3571914..3572009,3572066..3572181,3572232..3572362,3572441..3572769,35 72824..3572952,3573022..3573210)


exon

Literature and cross-references SmRboh06-1_0 (SmRboh06a_0)
DNA ref. Phytozome 11:   scaffold_0 (3570486..3573210)
mRNA ref. JGI transcript:   74260
EST ref. GenBank:   FE458776.1 [3' end]   FE458777.1 [Fragment]
Protein sequence: SmRboh06-1_0 (SmRboh06a_0)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   711
PWM (Da):   %s   80767.83 Transmb domain:   %s   o308-330i351-373o383-400i537-554o
PI (pH):   %s   8.9
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPESEEFAAELLGVLRRRRAHSRGVTTSAVEDRHDIGKDELWDLWMDLTDKTTASRMQIFFDLCDRDRDGKISGSELKAILLSASANRLSILDEQAEEYAALLMEELDREKKGEVGISQLESLLSKRAFEADSFRQHYQSHYPCNAERLGRLQFLACSTKNAFQEDWRRLWIVGVWFGAMAALFMWKSMQYSYRSGFEVMGYCVSMAKGAAETLKLNMALILFPVCRNTITWLRSTRLGSVIPFDDSISFHKTVAGAICLGVLIHGGAHLTCDFPRIANAESKTFMRTLGRDFHGCQPSMLGMVMSVEGVTGIAMVILMAVSFLLATNLARKNRLKLRRPFDKLTGFNVFWYSHHLFAIVYALLIVHSTLLFLTHKWSEKTTWLYILVPTVLYIGERFLRVSRACIYKVDIVQAAIFPGNVLSLHMTKPPGFKYQSGMYIFIQCPSISPFEWHPFSITSAPGDEHLSVHVRSLGDWTEEIMRTFAKVHNDSRLCMKFSQKKTERHNQTECMNRFPKLYIDGPYGAAAQDYRKYDVMLLVGLGIGATPFISILRDMLNTQTGKPEYQQSPRRCPSHAYFYWVTKEQGSFQWFKGVMNEVAEMDHAVIEMHNYLTCVHEEGDARSALITLVQALHHAKSGVDIVSGTRVRTHFARPNWNKVFARLAANHPGARVGVFYCGMASAAKELEGIAWTFSQRTSTRFEFRKESF*

Retrieve as FASTA  
Remarks Complete sequence from genomic (10 introns) and 2 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCGGAGAGCGAGGAGTTTGCCGCGGAGCTCCTGGGCGTCTTGCGGCGCCGGAGAGCGCACTCCCGGGGCGTCACCACCAGCGCCGTCGAGGATCGTCACGACATTGGCAAGGATGAG
CTCTGGGATCTCTGGATGGATCTCACAGACAAGACGACCGCCTCGAGGATGCAAATCTTCTTCGATCT
GTAAGGATTTCTTTCTAGAAATGCCCTGTGATCGATCGATCGTGTGCTTCGC
AGATGCGATCGAGACCGGGATGGAAAGATCAGTGGGTCGGAGCTAAAAAGTGTACGTTCGAGCTAGTTTCGTATTTTCTCCAGGCTTATGGTTGATCACTCTCAGGCCATCCTTCTGAGC
GCGTCGGCCAACCGACTCTCGATTCTCGACGAGCAGGCGGAGGAGTACGCGGCATTGTTGATGGAAGAACTGGATCGTGAGAAGAAAGGCGAAGTTGGC
GTAAGTTTTTCTTTCTCGTCT
TCGATTACATTCTTTACTCAAACTCGACTCGATCATCTTCATCACAGATATCACAGCTCGAGAGCTTATTAAGCAAGCGCGCCTTTGAGGCTGATTCGTTCCGGCAGCACTACCAGAGCC
ATTACCCGTGTAACGCCGAAAGGCTGGGGAGGCTACAGTTCCTTGCTTGCAGCACCAAGAATGCTTTCCAAGAGGATTGGCGTCGACTCTGGATTGTTGGCGTGTGGTTTGGAGCCATGG
CCGCGCTGTTTATGTGGAAGTCCATGCAGTACAGCTACCGGTCCGGCTTTGAAGTGATGGGGTATTGCGTGAGCATGGCCAAAGGTGCTGCCGAGACACTCAAGCTCAACATGGCACTCA
TCCTTTTCCCTGTTTGTAGAAACACTATAACGTGGCTCCGCTCTACCAGGCTCGGCTCAGTGATTCCCTTCGATGACAGCATCAGCTTTCACAAG
GTAAAAAAGTCCATTTCTTTTTTTC
TGTAAGCTTCTTTGTTTACTGTTTTCATACACAGACAGTGGCAGGAGCTATTTGTTTGGGAGTGCTTATTCACGGAGGAGCTCATTTGACCTGTGACTTCCCCCGCATTGCCAATGCAGA
GTCGAAGACTTTCATGCGTACTCTGGGAAGAGACTTTCACGGCTGCCAGCCTTCTATGCTGGGCATGGTCATGTCCGTCGAAGGCGTGACAGGGATCGCGATGGTTATATTGATGGCCGT
GTCGTTTCTTCTTGCGACCAACCTCGCGAGGAAGAACAGGCTCAAGCTCCGCCGACCCTTTGACAAACTTACCGGGTTCAACGTGTTCTGGTATTCTCACCATCTGTTCGCCATTGTCTA
CGCTCTCTTGATTGTTCACTCGACATTACTTTTCCTCACGCACAAATGGTCAGAGAAAACG
GTATGTGTGTCAGTATTTGTCAATATACTAATGTTTTTTCTCCATAGACGTGGTTGTAC
ATTCTTGTTCCAACAGTTCTTTACATTGGAGAACGGTTTTTGAGAGTATCTAGAGCATGCATTTACAAGGTTGACATTGTACAG
GTAATTATACTAATTTTTTGTAACTTACCAGATCAA
TGAACTCGTTTGTTTTCTAGGCTGCCATTTTTCCCGGAAATGTTTTGTCTCTTCACATGACAAAACCTCCCGGCTTTAAATACCAGAGTGGGATGTACATCTTTATTCAATGCCCCTCAA
TATCGCCATTCGAATG
GTAAGACCTTGAAACTTCTCGTATACAATGTTTACATGTATGCGATGTAGGCACCCGTTTTCAATCACGTCAGCACCAGGAGATGAACACCTCAGTGTTCATGT
TCGCAGCTTGGGGGACTGGACGGAAGAGATCATGAGGACATTCGCAAAGGTGCACAATGATTCTCGATTGTGCTCGA
GTTCTTACCACAGACATTAGGAGATCGAAGCACAAGGAGAAGA
CAGTGGTGACGAAGGCGCACTCAGAAGGTAATGAGTGAAATTTTCTCAAAAGAAAACCGAAAGGCACAATCAAACTGAATGCATGAACAGATTTCCAAAGCTTTACATAGATGGACCTTA
CGGAGCTGCAGCGCAGGATTACCGCAAATACGACGTGATGCTCCTTGTCGGACTTGGAATCGGGGCAACGCCGTTTATCAGCATTCTCAGGGACATGCTCAACACTCAGACGGGGAAGCC
GGAGTACCAGCAGTCCCCGCGACGCTGTCCAAGCCACGCTTACTTCTACTGGGTGACCAAAGAACAAGGCTCCTTCCAGTGGTTCAAGGGGGTGATGAACGAGGTGGCCGAGATGGATCA
CAAG
GTACAACACAATTTTTTGTCTAAGTCTTCCTGAGCTATGCGTGTACATCCACAGGCAGTGATTGAAATGCACAACTATCTGACGTGCGTTCACGAGGAAGGAGACGCTCGCTCGGC
CCTGATAACGCTCGTCCAGGCCCTCCATCACGCTAAGAGTGGCGTGGACATTGTCTCAGGAACTCGG
GTATAGCCAAACTCTTTTTCTCCTTTTCGCTCTGAATTTGCCTGGTGCTAACG
CGGTCCAGCGAAACAGGTTCGCACGCACTTTGCTCGGCCCAACTGGAACAAAGTTTTCGCGAGGCTGGCCGCAAACCATCCCGGTGCCCGTGTCGGCGTGTTCTACTGCGGCATGGCCTC
GGCAGCCAAGGAGCTGGAAGGAATCGCCTGGACCTTCTCGCAGAGAACCAGCACCAGGTTTGAGTTTCGAAAGGAGAGCTTTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCGGAGAGCGAGGAGTTTGCCGCGGAGCTCCTGGGCGTCTTGCGGCGCCGGAGAGCGCACTCCCGGGGCGTCACCACCAGCGCCGTCGAGGATCGTCACGACATTGGCAAGGATGAG
CTCTGGGATCTCTGGATGGATCTCACAGACAAGACGACCGCCTCGAGGATGCAAATCTTCTTCGATCT
ATGCGATCGAGACCGGGATGGAAAGATCAGTGGGTCGGAGCTAAAAAGTGCC
ATCCTTCTGAGCGCGTCGGCCAACCGACTCTCGATTCTCGACGAGCAGGCGGAGGAGTACGCGGCATTGTTGATGGAAGAACTGGATCGTGAGAAGAAAGGCGAAGTTGGC
ATATCACAG
CTCGAGAGCTTATTAAGCAAGCGCGCCTTTGAGGCTGATTCGTTCCGGCAGCACTACCAGAGCCATTACCCGTGTAACGCCGAAAGGCTGGGGAGGCTACAGTTCCTTGCTTGCAGCACC
AAGAATGCTTTCCAAGAGGATTGGCGTCGACTCTGGATTGTTGGCGTGTGGTTTGGAGCCATGGCCGCGCTGTTTATGTGGAAGTCCATGCAGTACAGCTACCGGTCCGGCTTTGAAGTG
ATGGGGTATTGCGTGAGCATGGCCAAAGGTGCTGCCGAGACACTCAAGCTCAACATGGCACTCATCCTTTTCCCTGTTTGTAGAAACACTATAACGTGGCTCCGCTCTACCAGGCTCGGC
TCAGTGATTCCCTTCGATGACAGCATCAGCTTTCACAAG
ACAGTGGCAGGAGCTATTTGTTTGGGAGTGCTTATTCACGGAGGAGCTCATTTGACCTGTGACTTCCCCCGCATTGCCAAT
GCAGAGTCGAAGACTTTCATGCGTACTCTGGGAAGAGACTTTCACGGCTGCCAGCCTTCTATGCTGGGCATGGTCATGTCCGTCGAAGGCGTGACAGGGATCGCGATGGTTATATTGATG
GCCGTGTCGTTTCTTCTTGCGACCAACCTCGCGAGGAAGAACAGGCTCAAGCTCCGCCGACCCTTTGACAAACTTACCGGGTTCAACGTGTTCTGGTATTCTCACCATCTGTTCGCCATT
GTCTACGCTCTCTTGATTGTTCACTCGACATTACTTTTCCTCACGCACAAATGGTCAGAGAAAACG
ACGTGGTTGTACATTCTTGTTCCAACAGTTCTTTACATTGGAGAACGGTTTTTG
AGAGTATCTAGAGCATGCATTTACAAGGTTGACATTGTACAG
GCTGCCATTTTTCCCGGAAATGTTTTGTCTCTTCACATGACAAAACCTCCCGGCTTTAAATACCAGAGTGGGATGTAC
ATCTTTATTCAATGCCCCTCAATATCGCCATTCGAATG
GCACCCGTTTTCAATCACGTCAGCACCAGGAGATGAACACCTCAGTGTTCATGTTCGCAGCTTGGGGGACTGGACGGAAGAG
ATCATGAGGACATTCGCAAAGGTGCACAATGATTCTCGATTGTGCTCGA
TGAAATTTTCTCAAAAGAAAACCGAAAGGCACAATCAAACTGAATGCATGAACAGATTTCCAAAGCTTTAC
ATAGATGGACCTTACGGAGCTGCAGCGCAGGATTACCGCAAATACGACGTGATGCTCCTTGTCGGACTTGGAATCGGGGCAACGCCGTTTATCAGCATTCTCAGGGACATGCTCAACACT
CAGACGGGGAAGCCGGAGTACCAGCAGTCCCCGCGACGCTGTCCAAGCCACGCTTACTTCTACTGGGTGACCAAAGAACAAGGCTCCTTCCAGTGGTTCAAGGGGGTGATGAACGAGGTG
GCCGAGATGGATCACAAG
GCAGTGATTGAAATGCACAACTATCTGACGTGCGTTCACGAGGAAGGAGACGCTCGCTCGGCCCTGATAACGCTCGTCCAGGCCCTCCATCACGCTAAGAGT
GGCGTGGACATTGTCTCAGGAACTCGG
GTTCGCACGCACTTTGCTCGGCCCAACTGGAACAAAGTTTTCGCGAGGCTGGCCGCAAACCATCCCGGTGCCCGTGTCGGCGTGTTCTACTGC
GGCATGGCCTCGGCAGCCAAGGAGCTGGAAGGAATCGCCTGGACCTTCTCGCAGAGAACCAGCACCAGGTTTGAGTTTCGAAAGGAGAGCTTTTAA

Retrieve as FASTA