Entry information : SmRboh06-2_8 (SmRboh06b_8)
Entry ID 7391
Creation 0000-00-00 (Christophe Dunand)
Last sequence changes 2010-06-01 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmRboh06-2_8 (SmRboh06b_8)
Name (synonym) SmRboh06-2_8 (SmRboh06b_8)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmRboh06-2_8
start..stop
S start..stop
SmRboh06-1_0 1425 0 67..756 1..711
SmRboh04-1_39 942 0 15..756 29..788
SmRboh04-2_88 935 0 15..756 29..789
SmRboh03-2_66 915 0 2..756 22..796
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1937638..1937833 196 N° 2 1937386..1937575 190 N° 3 1937283..1937331 49 N° 4 1937104..1937217 114
N° 5 1936628..1937035 408 N° 6 1936182..1936568 387 N° 7 1936038..1936133 96 N° 8 1935866..1935981 116
N° 9 1935693..1935815 123 N° 10 1935278..1935551 274 N° 11 1935095..1935223 129 N° 12 1934832..1935020 189
complement(join(1934832..1935020,1935095..1935223,1935278..1935551,1935693..1935 815,1935866..1935981,1936038..1936133,1936182..1936568,1936628..1937035,1937104. .1937217,1937283..1937331,1937386..1937575,1937638..1937833))


exon

Literature and cross-references SmRboh06-2_8 (SmRboh06b_8)
DNA ref. Phytozome 11:   scaffold_8 (1937833..1934832)
mRNA ref. JGI transcript:   86677
Protein sequence: SmRboh06-2_8 (SmRboh06b_8)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   756
PWM (Da):   %s   85329.19 Transmb domain:   %s   o374-396i417-439o449-466i582-599o
PI (pH):   %s   8.51
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPVVEDEDASAARNNVNSALEGLRFIDKRTASAGDEAVWHRVMERFEKLSSSDGKLPPGRFGACIGMPESEEFAAELLGVLRRRRAHSRGVTTSAVEDRHDIGKDELWDLWMDLTDKTTASRMQIFFDLCDRDRDGKISGSELKAILLSASANRLSILDEQAEEYAALLMEELDREKKGEVGISQLESLLSKRAFEADSFRQHYQSHHPCNAERLGRLQFLACSTKNAFQEDWRRLWIVGVWFGAMAVLFMWKSMQYSYRSGFEVMGYCVSMAKGAAETLKLNMALILFPVCRNTITWLRSTRLGSVIPFDDSISFHKTVAGAICLGVLIHGGAHLTCDFPRIANAESKTFMRTLGRDFHGCQPSMLGMVMSVEGVTGIAMVILMAVSFLLATNLARKNRLKLRRPFDKLTGFNVFWYSHHLFAIVYALLIVHSTLLFLTHKWSEKTTWLYILVPTVLYIGERFLRVSRACVYKVDIVQAAIFPGNVLSLHMTKPPGFKYQSGMYIFIQCPSISPFEWHPFSITSAPGDEHLSVHVRSLGDWTEEIMRTFAKVHNDSRLFPKLYIDGPYGAAAQDYRKYDVMLLVGLGIGATPFISILRDMLNTQTGKPEYQQSPRRCPSHAYFYWVTKEQGSFQWFKGVMNEVAEMDHAVIEMHNYLTCVHEEGDARSALITLVQALHHAKSGVDIVSGTRVRTHFARPNWNKVFARLAANHPGARVGVFYCGMASAAKELEGIAWTFSQRTSTRFEFRKESF*

Retrieve as FASTA  
Remarks Complete sequence from genomic (11 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCGGTGGTGGAGGACGAGGATGCCAGTGCTGCCAGGAACAATGTGAATAGCGCGCTGGAGGGCCTCCGCTTTATCGATAAGCGCACGGCGAGCGCTGGGGACGAGGCGGTGTGGCAC
AGAGTGATGGAGCGATTCGAGAAGCTCTCGAGCAGCGATGGAAAGCTCCCGCCTGGCCGATTTGGCGCGTGCATTG
GTATTTAGAGGACGATTTTCTTGGTTCTTGTGGAGTATTAGGTT
TCTTTGATCGCAATGCAGGGATGCCGGAGAGCGAGGAGTTTGCCGCGGAGCTCCTGGGCGTTTTGCGGCGCCGGAGAGCGCACTCCCGGGGCGTCACCACCAGCGCCGTCGAGGATCGTC
ACGACATTGGCAAGGATGAGCTCTGGGATCTCTGGATGGATCTCACAGATAAGACGACCGCCTCGAGGATGCAAATCTTCTTCGATCT
GTAAGGATTTCTTTCTAGAAATGCCCTGTGAT
CGATCGGTCGTGTGCTTCGCAGATGCGATCGAGACCGGGATGGAAAGATCAGTGGGTCGGAGCTAAAAAGTGTACGTTCGAGCTAGTTTCTTATTTTCTCCAGACTATAAGAAAGCTTAT
GGTTGATCACTCTCAGGCCATCCTTCTGAGCGCGTCGGCCAACCGACTCTCGATTCTCGACGAGCAGGCGGAGGAGTACGCGGCATTGTTGATGGAAGAACTGGATCGTGAGAAGAAAGG
CGAAGTTGGC
GTAAGTTTTTCTTTTTCGTCTTCGATTACATTCTTTACTCAAACTCGACTCGATCATCTTCATCACAGATATCACAGCTCGAGAGCTTATTAAGCAAGCGCGCCTTTGAG
GCTGATTCGTTCCGGCAGCACTACCAGAGCCATCACCCGTGTAACGCCGAAAGGCTGGGGAGGCTACAGTTCCTTGCTTGCAGCACCAAGAATGCTTTCCAAGAGGATTGGCGTCGACTC
TGGATTGTTGGCGTGTGGTTTGGAGCCATGGCCGTGCTGTTTATGTGGAAGTCCATGCAGTACAGCTACCGGTCCGGCTTTGAAGTGATGGGGTATTGCGTGAGCATGGCCAAAGGTGCT
GCCGAGACACTCAAGCTCAACATGGCACTCATCCTTTTCCCTGTTTGTAGAAACACTATAACGTGGCTCCGCTCTACCAGGCTCGGCTCAGTGATTCCCTTCGATGACAGCATCAGCTTT
CACAAG
GTAAAAAAGTCCATTTCTTTTTTTCTGTAAGCTTCTTTGTTTACTGTTTTCATACACAGACAGTGGCAGGAGCTATTTGTTTGGGAGTGCTTATTCACGGAGGAGCTCATTTGA
CCTGTGACTTCCCCCGGATTGCCAATGCAGAGTCGAAGACTTTCATGCGTACTTTGGGAAGAGACTTTCACGGCTGCCAGCCTTCTATGCTGGGCATGGTCATGTCCGTCGAAGGCGTGA
CAGGGATCGCGATGGTTATATTGATGGCGGTGTCGTTTCTTCTTGCGACCAACCTCGCCAGGAAGAACAGGCTCAAGCTCCGCCGACCCTTTGACAAACTTACCGGGTTCAACGTGTTCT
GGTATTCTCACCATCTATTCGCCATTGTCTACGCTCTCTTGATTGTTCACTCGACATTACTTTTCCTCACGCACAAATGGTCAGAGAAAACG
GTATGTGTGTCAGTATTTGTCTATATAC
TAATGTTTTTTTCTCCATAGACGTGGTTGTACATTCTTGTTCCAACAGTTCTTTACATTGGAGAACGGTTTTTGAGAGTATCTAGAGCATGCGTTTACAAGGTTGACATTGTACAGGTAA
TTATACTAAATTTTTGTAACTTACCAGATCAATGAACTCGTTTGTTTTCTAGGCTGCCATTTTTCCCGGAAATGTTTTGTCTCTTCACATGACAAAACCTCCCGGCTTTAAATACCAGAG
TGGGATGTACATCTTTATTCAATGCCCCTCAATATCGCCATTCGAATG
GTAAGACCTTGAAACTTCTCGGATACAATGTTTACGTGTATGCGATGTAGGCACCCGTTTTCAATCACGTCA
GCACCAGGAGATGAACACCTCAGTGTTCATGTTCGCAGCTTGGGGGACTGGACGGAAGAGATCATGAGGACATTCGCAAAGGTGCACAATGATTCTCGATT
GTGCTCGAGTTCTTACCAC
AGACATTAGGAGATCGAAGCACAAGGAGAAGACAGTGGTGACGAAGGCGCACTCAGAAGGTAATGAGTGAAATTTACTCAAAAGAAAACCAAAAGGCACAATCAAACTGAATGAATGAAC
AGATTTCCAAAGCTTTACATAGATGGACCTTACGGAGCTGCAGCGCAGGATTACCGCAAATACGACGTGATGCTCCTTGTCGGACTTGGAATCGGGGCAACGCCGTTTATCAGCATTCTC
AGGGACATGCTCAACACTCAGACGGGGAAGCCGGAGTACCAGCAGTCCCCGCGACGCTGTCCAAGCCACGCTTACTTCTACTGGGTGACCAAGGAACAAGGCTCCTTCCAGTGGTTCAAG
GGGGTGATGAACGAGGTGGCCGAGATGGATCACAAG
GTACAACACAATTTTTTGTCTAAGTCTTCCTGAGCTATGCTTGTGCATCCACAGGCAGTGATTGAAATGCACAACTATCTGACG
TGCGTTCACGAGGAAGGAGACGCTCGCTCGGCCCTGATAACGCTCGTCCAGGCCCTCCATCACGCTAAGAGTGGCGTGGACATTGTCTCAGGAACTCGG
GTATAGCCAAACTCTTTTCTC
CTTTTCGCTCTGAATTTCTAGCTGCCTGGTGCTAACGCGGTCGAGCGAAACAGGTTCGCACGCACTTTGCTCGGCCCAACTGGAACAAAGTTTTCGCGAGGCTGGCCGCAAACCATCCCG
GTGCCCGTGTCGGCGTGTTCTACTGCGGCATGGCCTCGGCAGCCAAGGAGCTGGAAGGAATCGCCTGGACCTTCTCGCAGAGAACCAGCACCAGGTTTGAGTTTCGAAAGGAGAGCTTTT
AA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCGGTGGTGGAGGACGAGGATGCCAGTGCTGCCAGGAACAATGTGAATAGCGCGCTGGAGGGCCTCCGCTTTATCGATAAGCGCACGGCGAGCGCTGGGGACGAGGCGGTGTGGCAC
AGAGTGATGGAGCGATTCGAGAAGCTCTCGAGCAGCGATGGAAAGCTCCCGCCTGGCCGATTTGGCGCGTGCATTG
GGATGCCGGAGAGCGAGGAGTTTGCCGCGGAGCTCCTGGGCGTT
TTGCGGCGCCGGAGAGCGCACTCCCGGGGCGTCACCACCAGCGCCGTCGAGGATCGTCACGACATTGGCAAGGATGAGCTCTGGGATCTCTGGATGGATCTCACAGATAAGACGACCGCC
TCGAGGATGCAAATCTTCTTCGATCT
ATGCGATCGAGACCGGGATGGAAAGATCAGTGGGTCGGAGCTAAAAAGTGCCATCCTTCTGAGCGCGTCGGCCAACCGACTCTCGATTCTCGAC
GAGCAGGCGGAGGAGTACGCGGCATTGTTGATGGAAGAACTGGATCGTGAGAAGAAAGGCGAAGTTGGC
ATATCACAGCTCGAGAGCTTATTAAGCAAGCGCGCCTTTGAGGCTGATTCG
TTCCGGCAGCACTACCAGAGCCATCACCCGTGTAACGCCGAAAGGCTGGGGAGGCTACAGTTCCTTGCTTGCAGCACCAAGAATGCTTTCCAAGAGGATTGGCGTCGACTCTGGATTGTT
GGCGTGTGGTTTGGAGCCATGGCCGTGCTGTTTATGTGGAAGTCCATGCAGTACAGCTACCGGTCCGGCTTTGAAGTGATGGGGTATTGCGTGAGCATGGCCAAAGGTGCTGCCGAGACA
CTCAAGCTCAACATGGCACTCATCCTTTTCCCTGTTTGTAGAAACACTATAACGTGGCTCCGCTCTACCAGGCTCGGCTCAGTGATTCCCTTCGATGACAGCATCAGCTTTCACAAG
ACA
GTGGCAGGAGCTATTTGTTTGGGAGTGCTTATTCACGGAGGAGCTCATTTGACCTGTGACTTCCCCCGGATTGCCAATGCAGAGTCGAAGACTTTCATGCGTACTTTGGGAAGAGACTTT
CACGGCTGCCAGCCTTCTATGCTGGGCATGGTCATGTCCGTCGAAGGCGTGACAGGGATCGCGATGGTTATATTGATGGCGGTGTCGTTTCTTCTTGCGACCAACCTCGCCAGGAAGAAC
AGGCTCAAGCTCCGCCGACCCTTTGACAAACTTACCGGGTTCAACGTGTTCTGGTATTCTCACCATCTATTCGCCATTGTCTACGCTCTCTTGATTGTTCACTCGACATTACTTTTCCTC
ACGCACAAATGGTCAGAGAAAACG
ACGTGGTTGTACATTCTTGTTCCAACAGTTCTTTACATTGGAGAACGGTTTTTGAGAGTATCTAGAGCATGCGTTTACAAGGTTGACATTGTACAG
GCTGCCATTTTTCCCGGAAATGTTTTGTCTCTTCACATGACAAAACCTCCCGGCTTTAAATACCAGAGTGGGATGTACATCTTTATTCAATGCCCCTCAATATCGCCATTCGAATGGCAC
CCGTTTTCAATCACGTCAGCACCAGGAGATGAACACCTCAGTGTTCATGTTCGCAGCTTGGGGGACTGGACGGAAGAGATCATGAGGACATTCGCAAAGGTGCACAATGATTCTCGATT
A
TTTCCAAAGCTTTACATAGATGGACCTTACGGAGCTGCAGCGCAGGATTACCGCAAATACGACGTGATGCTCCTTGTCGGACTTGGAATCGGGGCAACGCCGTTTATCAGCATTCTCAGG
GACATGCTCAACACTCAGACGGGGAAGCCGGAGTACCAGCAGTCCCCGCGACGCTGTCCAAGCCACGCTTACTTCTACTGGGTGACCAAGGAACAAGGCTCCTTCCAGTGGTTCAAGGGG
GTGATGAACGAGGTGGCCGAGATGGATCACAAG
GCAGTGATTGAAATGCACAACTATCTGACGTGCGTTCACGAGGAAGGAGACGCTCGCTCGGCCCTGATAACGCTCGTCCAGGCCCTC
CATCACGCTAAGAGTGGCGTGGACATTGTCTCAGGAACTCGG
GTTCGCACGCACTTTGCTCGGCCCAACTGGAACAAAGTTTTCGCGAGGCTGGCCGCAAACCATCCCGGTGCCCGTGTC
GGCGTGTTCTACTGCGGCATGGCCTCGGCAGCCAAGGAGCTGGAAGGAATCGCCTGGACCTTCTCGCAGAGAACCAGCACCAGGTTTGAGTTTCGAAAGGAGAGCTTTTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCGGTGG TGGAGGACGA GGATGCCAGT GCTGCCAGGA ACAATGTGAA TAGCGCGCTG GAGGGCCTCC GCTTTATCGA TAAGCGCACG GCGAGCGCTG GGGACGAGGC GGTGTGGCAC  AGAGTGATGG AGCGATTCGA GAAGCTCTCG AGCAGCGATG GAAAGCTCCC GCCTGGCCGA TTTGGCGCGT GCATTGGGAT GCCGGAGAGC GAGGAGTTTG CCGCGGAGCT CCTGGGCGTT  TTGCGGCGCC GGAGAGCGCA CTCCCGGGGC GTCACCACCA GCGCCGTCGA GGATCGTCAC GACATTGGCA AGGATGAGCT CTGGGATCTC TGGATGGATC TCACAGATAA GACGACCGCC  TCGAGGATGC AAATCTTCTT CGATCTATGC GATCGAGACC GGGATGGAAA GATCAGTGGG TCGGAGCTAA AAAGTGCCAT CCTTCTGAGC GCGTCGGCCA ACCGACTCTC GATTCTCGAC  GAGCAGGCGG AGGAGTACGC GGCATTGTTG ATGGAAGAAC TGGATCGTGA GAAGAAAGGC GAAGTTGGCA TATCACAGCT CGAGAGCTTA TTAAGCAAGC GCGCCTTTGA GGCTGATTCG  TTCCGGCAGC ACTACCAGAG CCATCACCCG TGTAACGCCG AAAGGCTGGG GAGGCTACAG TTCCTTGCTT GCAGCACCAA GAATGCTTTC CAAGAGGATT GGCGTCGACT CTGGATTGTT  GGCGTGTGGT TTGGAGCCAT GGCCGTGCTG TTTATGTGGA AGTCCATGCA GTACAGCTAC CGGTCCGGCT TTGAAGTGAT GGGGTATTGC GTGAGCATGG CCAAAGGTGC TGCCGAGACA  CTCAAGCTCA ACATGGCACT CATCCTTTTC CCTGTTTGTA GAAACACTAT AACGTGGCTC CGCTCTACCA GGCTCGGCTC AGTGATTCCC TTCGATGACA GCATCAGCTT TCACAAGACA  GTGGCAGGAG CTATTTGTTT GGGAGTGCTT ATTCACGGAG GAGCTCATTT GACCTGTGAC TTCCCCCGGA TTGCCAATGC AGAGTCGAAG ACTTTCATGC GTACTTTGGG AAGAGACTTT  CACGGCTGCC AGCCTTCTAT GCTGGGCATG GTCATGTCCG TCGAAGGCGT GACAGGGATC GCGATGGTTA TATTGATGGC GGTGTCGTTT CTTCTTGCGA CCAACCTCGC CAGGAAGAAC  AGGCTCAAGC TCCGCCGACC CTTTGACAAA CTTACCGGGT TCAACGTGTT CTGGTATTCT CACCATCTAT TCGCCATTGT CTACGCTCTC TTGATTGTTC ACTCGACATT ACTTTTCCTC  ACGCACAAAT GGTCAGAGAA AACGACGTGG TTGTACATTC TTGTTCCAAC AGTTCTTTAC ATTGGAGAAC GGTTTTTGAG AGTATCTAGA GCATGCGTTT ACAAGGTTGA CATTGTACAG  GCTGCCATTT TTCCCGGAAA TGTTTTGTCT CTTCACATGA CAAAACCTCC CGGCTTTAAA TACCAGAGTG GGATGTACAT CTTTATTCAA TGCCCCTCAA TATCGCCATT CGAATGGCAC  CCGTTTTCAA TCACGTCAGC ACCAGGAGAT GAACACCTCA GTGTTCATGT TCGCAGCTTG GGGGACTGGA CGGAAGAGAT CATGAGGACA TTCGCAAAGG TGCACAATGA TTCTCGATTA  TTTCCAAAGC TTTACATAGA TGGACCTTAC GGAGCTGCAG CGCAGGATTA CCGCAAATAC GACGTGATGC TCCTTGTCGG ACTTGGAATC GGGGCAACGC CGTTTATCAG CATTCTCAGG  GACATGCTCA ACACTCAGAC GGGGAAGCCG GAGTACCAGC AGTCCCCGCG ACGCTGTCCA AGCCACGCTT ACTTCTACTG GGTGACCAAG GAACAAGGCT CCTTCCAGTG GTTCAAGGGG  GTGATGAACG AGGTGGCCGA GATGGATCAC AAGGCAGTGA TTGAAATGCA CAACTATCTG ACGTGCGTTC ACGAGGAAGG AGACGCTCGC TCGGCCCTGA TAACGCTCGT CCAGGCCCTC  CATCACGCTA AGAGTGGCGT GGACATTGTC TCAGGAACTC GGGTTCGCAC GCACTTTGCT CGGCCCAACT GGAACAAAGT TTTCGCGAGG CTGGCCGCAA ACCATCCCGG TGCCCGTGTC 
GGCGTGTTCT ACTGCGGCAT GGCCTCGGCA GCCAAGGAGC TGGAAGGAAT CGCCTGGACC TTCTCGCAGA GAACCAGCAC CAGGTTTGAG TTTCGAAAGG AGAGCTTTTA A 

Retrieve as FASTA