Entry information : SmRboh09-1_82 (SmRboh09a_82)
Entry ID 7392
Creation 0000-00-00 (Christophe Dunand)
Last sequence changes 2010-06-01 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmRboh09-1_82 (SmRboh09a_82)
Name (synonym) SmRboh09-1_82 (SmRboh09a_82)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmRboh09-1_82
start..stop
S start..stop
SmRboh09-2_83 1470 0 119..825 1..707
SmRboh02-2_137 981 0 2..825 71..902
SmRboh02-1_19 979 0 2..825 64..895
SmRboh05-1_24 943 0 54..825 122..901
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 711440..711791 352 N° 2 711876..712035 160 N° 3 712094..712142 49 N° 4 712226..712339 114
N° 5 712409..712834 426 N° 6 712897..713283 387 N° 7 713369..713464 96 N° 8 713528..713643 116
N° 9 713716..713818 103 N° 10 713869..713954 86 N° 11 714018..714171 154 N° 12 714230..714346 117
N° 13 714403..714531 129 N° 14 714591..714669 79 N° 15 714765..714874 110  
join(711440..711791,711876..712035,712094..712142,712226..712339,712409..712834, 712897..713283,713369..713464,713528..713643,713716..713818,713869..713954,71401 8..714171,714230..714346,714403..714531,714591..714669,714765..714874)


exon

Literature and cross-references SmRboh09-1_82 (SmRboh09a_82)
DNA ref. Phytozome 11:   scaffold_82 (711440..714874)
mRNA ref. JGI transcript:   183259 [Incorrect prediction]
Protein sequence: SmRboh09-1_82 (SmRboh09a_82)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   825
PWM (Da):   %s   93705.5 Transmb domain:   %s   o284-306i422-444o471-493i652-669o
PI (pH):   %s   9.99
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVNDDGVSVSSDRPLHRTESIASGGGEKRSAVVTAIKVKTAFTRLASTVRNHNSPKATKFDRAKQAKFSRTKSNALQGLRFLTGKNKKKVSWLDIERRFTVLAVDGSLSREKFGECIGMETSEFAQALFDALVSSKKLENQQSISKEVLHAFWLQMSDDSFDSRMQIFFQMFDRNADGHISEEEVKIIMLSAATNKLAKLKAQADEFAALIMEELDPDKNGFIELSQLEALMRVPEPAHAKDSFLNYSTTISRNLVGVKRKKHTPLLSFWKDSKFYLSENWRYLMFFGLWIATMAGLFAWKFFVYKQRAAFEVMGYCLCVAKGAAETLKLNMALVLFPVCRNTITWFRSTFVGNIVPFNDNLKFHMMIASGVAIGTVIHAGVHLACDFPRITSSSDELFMRTLGKSFHYKRQTYVDLLKSVAGVTGIASVLLMAFIFLLATPWFRRGQVKPLWPLHRLSGFNAFWYSHHLFIFVYVLLIVHSLFIYLAHGWWQKTTWMYLAIPVALYASERLVRAIRAGLYTVRVVKAAVYPGNVLALYIQKPRGFKYKSGMYLFLKCPAISHLQWHPFSITSAPSDDYLSIHIRSAGDWTSKMKKIFSVCHKPEVGKSGLLRAEYVDHDLEFQSQPRFPKLRIDGPYGAPAQDYMKYDVLLLVGLGIGATPFVSILRDILNHVNRDVNNGKKSGPTKVYFYWVTREQGSFEWFKGVMNEIAEMDHKRVIEMHNYLTSVYEEGDARSALITMIQALNLAKNGVDILSGTRVRTHFARPNWKTVFSRLSAVHRHANIGVFYCGAPAVAKELDTLSREYTHQNSTTFDFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (14 introns). Incorrect prediction from JGI (confirmed by EST of the other haplotype).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCAACGACGATGGAGTTTCAGTGTCTAGCGATCGTCCTCTCCATCGCACCGAGTCCATTGCTTCGGGTGGAGGCGAGAAGAGATCCGCTGTGGTCACGGCCATCAAAGTTAAGACT
GCTTTCACTCGTCTCGCCAGCACTGTCAGGAATCACAACTCTCCAAAGGCCACCAAGTTTGATCGAGCGAAGCAAGCAAAGTTTTCCAGGACAAAGTCCAATGCCCTCCAGGGACTTCGT
TTCCTTACCGGGAAGAACAAGAAGAAAGTGTCGTGGCTCGACATCGAAAGGAGATTCACGGTGCTGGCAGTGGATGGAAGCCTTTCTCGTGAAAAATTCGGTGAATGCATAG
GTGAAGTT
CCAATGTTTTCTACCTTCCTTTTTCTTTTCTTCTTCAATCTTCTGACTATCAAGCTTTTGTGTTCTTTGCTTTCAGGAATGGAGACCTCGGAATTTGCTCAAGCGCTCTTCGATGCGCTC
GTCTCCAGCAAGAAACTCGAGAACCAGCAAAGCATTTCCAAGGAAGTTCTTCACGCCTTCTGGCTGCAAATGAGCGACGATAGCTTCGACTCTCGTATGCAAATTTTCTTCCAGAT
GTAA
GTTCTCGATTGTGATCAAGATGCAGTGATTTCGAATCGTTTCTTCGTTCCTCAGGTTCGACAGAAACGCAGACGGACATATATCAGAAGAAGAAGTCAAAGAGGTGATTGATTGAGAGTG
AGTGACAACCATCTTGCTCTTCTCTTAACTCTTTTTTTTTTTCCTTGGTGCGGCACAATCGTGTAGATTATCATGCTTAGTGCGGCAACCAACAAGCTTGCCAAGCTCAAGGCACAAGCC
GACGAGTTTGCCGCGTTAATTATGGAAGAGTTGGATCCTGACAAGAATGGCTTCATTGAG
GTAAATATTTCCACGATGCCATGATCGAGCTTCATAGTTTTCCTTGTCCACTTTTCTTTT
TCCTGGCAGCTTTCGCAGCTCGAAGCTTTGATGAGAGTTCCGGAGCCAGCGCATGCCAAAGACTCTTTCCTCAACTACAGCACAACCATCTCTCGGAATCTCGTCGGCGTCAAGCGGAAA
AAGCACACTCCACTTCTCTCCTTTTGGAAAGATTCGAAGTTCTACCTCTCCGAGAACTGGAGGTACCTCATGTTCTTCGGACTTTGGATTGCGACCATGGCGGGATTGTTCGCGTGGAAG
TTTTTCGTGTACAAGCAGCGAGCAGCTTTTGAAGTCATGGGATATTGTCTGTGCGTCGCAAAAGGTGCTGCCGAGACTCTCAAGCTCAACATGGCACTCGTGCTTTTCCCGGTCTGTAGA
AACACCATCACCTGGTTTCGTTCGACCTTCGTCGGCAACATCGTTCCGTTCAACGACAACCTCAAGTTTCATATG
GTACTTACAACCTTTGATCTTTTGTTTTCGTCTTCTTCTTCTGAA
AGTTCTTTTTCGTCCAGATGATTGCGTCTGGTGTTGCAATTGGAACTGTGATTCACGCTGGAGTCCACTTGGCCTGCGACTTCCCGAGAATTACTAGCTCGTCTGACGAGCTCTTCATGC
GCACCCTCGGCAAAAGTTTTCATTACAAGAGACAAACGTACGTTGATCTGCTCAAGTCAGTGGCTGGGGTTACTGGGATCGCGAGCGTGCTGCTCATGGCTTTTATATTCCTGCTAGCGA
CGCCATGGTTCAGGCGAGGCCAGGTAAAGCCACTGTGGCCTTTGCACAGGCTAAGCGGATTCAACGCCTTTTGGTACTCGCACCATTTGTTTATCTTTGTCTACGTCCTGCTCATTGTCC
ACTCGCTTTTCATTTATTTGGCACATGGATGGTGGCAGAAAACG
GTTCGTAAGTGGCTCCTTTGTTCTTTGAGACTTGTTTTTCCACTGACGAGTTTTCTCTTTTCTCTCGTTTTGGTTT
CTTGCACAGACTTGGATGTATCTCGCGATTCCAGTGGCTTTATATGCTTCTGAGCGATTGGTACGAGCCATCCGTGCGGGACTGTATACAGTTCGTGTAGTCAAGGTCTGGCACGAAGCT
TTTCTTTAGGATTTCGTTCATGGTTTTGATTGAGCAGTTTAACTACAGGCTGCTGTTTATCCTGGAAATGTCTTGGCTTTGTACATACAAAAGCCTCGCGGTTTTAAGTACAAGAGTGGC
ATGTATCTCTTCCTCAAGTGCCCGGCCATCTCGCACCTTCAATG
GTAAGTACTAGTAGTTCCTTGGCTTTTTTTTTTCTTTTCTTTAGTCAGCAAGCTTTGATCTTTTCATCACAGGCAT
CCTTTTTCGATCACTTCTGCTCCAAGTGATGACTACTTGAGCATCCATATAAGAAGTGCCGGGGACTGGACCTCCAAAATGAAGAAAATCTTCTCAGAG
GTACGTATGCTGCGATACATT
TGAACTCCAACTCTGAAAGCCGTGTACAGGTTTGCCACAAACCCGAAGTTGGCAAAAGTGGCTTGCTCAGAGCTGAGTATGTGGATCATGATCTGGAGTTCCAGTCACAACCAAGGTAGG
AAAAATAGATTTAGAATTGTACAGAAAAGCTGTGTCTTTTTTTTTTCGTCTATTGCAGGTTTCCAAAGCTACGAATTGATGGTCCCTATGGTGCTCCAGCACAAGATTACATGAAGTATG
ATGTGCTGCTGCTCGTTGGTCTTGGCATTGGAGCAACACCTTTCGTAAGTATTCTGAGAGACATCTTGAATCACGTCAACAGGGATGTGGAA
GTAAGTTCTTCCAAGTTACTCAAGCTAC
AAACTCATTCTCATTTCGTTGGGATCGCAGAACAATGGGAAGAAGAGCGGTCCTACAAAAGTTTACTTCTACTGGGTGACTAGAGAGCAGGGATCTTTCGAATGGTTTAAAGGTGTCATG
AACGAGATTGCAGAGATGGATCACAAG
GTCGGATTTTTCTCGCATTCTTTTGCTTAATAGTTTGCATGAACTTTGACGAGCAGAGAGTTATCGAGATGCACAACTATCTCACGAGTGTGT
ACGAGGAGGGCGACGCTCGATCGGCACTGATCACCATGATCCAGGCTTTGAACCTGGCCAAAAACGGAGTGGACATCTTGTCTGGAACTCGG
GTACGTACGAAGATTTCTTCTAGTTCCT
GTAGTTTCTAAAAACTTTCGCTCCTCTCCAGGTAAGAACACATTTTGCGAGACCAAACTGGAAGACGGTGTTTTCACGGCTCTCAGCAGTTCACAGGCATGCTAACATCGGTGAGTGATT
AATTCTCAAGACAAAGCTTTGGTCTAGCATCTAGAAAAGAGAAAAGGAGCCATCACTCCCGTTTTCCACGTTTTGTTCCTTGCAGGCGTATTTTACTGTGGTGCCCCAGCAGTGGCGAAA
GAATTGGACACACTGTCGCGAGAGTACACGCACCAGAACTCAACCACCTTCGATTTTCACAAGGAAAACTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCAACGACGATGGAGTTTCAGTGTCTAGCGATCGTCCTCTCCATCGCACCGAGTCCATTGCTTCGGGTGGAGGCGAGAAGAGATCCGCTGTGGTCACGGCCATCAAAGTTAAGACT
GCTTTCACTCGTCTCGCCAGCACTGTCAGGAATCACAACTCTCCAAAGGCCACCAAGTTTGATCGAGCGAAGCAAGCAAAGTTTTCCAGGACAAAGTCCAATGCCCTCCAGGGACTTCGT
TTCCTTACCGGGAAGAACAAGAAGAAAGTGTCGTGGCTCGACATCGAAAGGAGATTCACGGTGCTGGCAGTGGATGGAAGCCTTTCTCGTGAAAAATTCGGTGAATGCATAG
GAATGGAG
ACCTCGGAATTTGCTCAAGCGCTCTTCGATGCGCTCGTCTCCAGCAAGAAACTCGAGAACCAGCAAAGCATTTCCAAGGAAGTTCTTCACGCCTTCTGGCTGCAAATGAGCGACGATAGC
TTCGACTCTCGTATGCAAATTTTCTTCCAGAT
GTTCGACAGAAACGCAGACGGACATATATCAGAAGAAGAAGTCAAAGAGATTATCATGCTTAGTGCGGCAACCAACAAGCTTGCCAAG
CTCAAGGCACAAGCCGACGAGTTTGCCGCGTTAATTATGGAAGAGTTGGATCCTGACAAGAATGGCTTCATTGAG
CTTTCGCAGCTCGAAGCTTTGATGAGAGTTCCGGAGCCAGCGCAT
GCCAAAGACTCTTTCCTCAACTACAGCACAACCATCTCTCGGAATCTCGTCGGCGTCAAGCGGAAAAAGCACACTCCACTTCTCTCCTTTTGGAAAGATTCGAAGTTCTACCTCTCCGAG
AACTGGAGGTACCTCATGTTCTTCGGACTTTGGATTGCGACCATGGCGGGATTGTTCGCGTGGAAGTTTTTCGTGTACAAGCAGCGAGCAGCTTTTGAAGTCATGGGATATTGTCTGTGC
GTCGCAAAAGGTGCTGCCGAGACTCTCAAGCTCAACATGGCACTCGTGCTTTTCCCGGTCTGTAGAAACACCATCACCTGGTTTCGTTCGACCTTCGTCGGCAACATCGTTCCGTTCAAC
GACAACCTCAAGTTTCATATG
ATGATTGCGTCTGGTGTTGCAATTGGAACTGTGATTCACGCTGGAGTCCACTTGGCCTGCGACTTCCCGAGAATTACTAGCTCGTCTGACGAGCTCTTC
ATGCGCACCCTCGGCAAAAGTTTTCATTACAAGAGACAAACGTACGTTGATCTGCTCAAGTCAGTGGCTGGGGTTACTGGGATCGCGAGCGTGCTGCTCATGGCTTTTATATTCCTGCTA
GCGACGCCATGGTTCAGGCGAGGCCAGGTAAAGCCACTGTGGCCTTTGCACAGGCTAAGCGGATTCAACGCCTTTTGGTACTCGCACCATTTGTTTATCTTTGTCTACGTCCTGCTCATT
GTCCACTCGCTTTTCATTTATTTGGCACATGGATGGTGGCAGAAAACG
ACTTGGATGTATCTCGCGATTCCAGTGGCTTTATATGCTTCTGAGCGATTGGTACGAGCCATCCGTGCGGGA
CTGTATACAGTTCGTGTAGTCAAG
GCTGCTGTTTATCCTGGAAATGTCTTGGCTTTGTACATACAAAAGCCTCGCGGTTTTAAGTACAAGAGTGGCATGTATCTCTTCCTCAAGTGCCCG
GCCATCTCGCACCTTCAATG
GCATCCTTTTTCGATCACTTCTGCTCCAAGTGATGACTACTTGAGCATCCATATAAGAAGTGCCGGGGACTGGACCTCCAAAATGAAGAAAATCTTCTCA
GAG
GTTTGCCACAAACCCGAAGTTGGCAAAAGTGGCTTGCTCAGAGCTGAGTATGTGGATCATGATCTGGAGTTCCAGTCACAACCAAGGTTTCCAAAGCTACGAATTGATGGTCCCTAT
GGTGCTCCAGCACAAGATTACATGAAGTATGATGTGCTGCTGCTCGTTGGTCTTGGCATTGGAGCAACACCTTTCGTAAGTATTCTGAGAGACATCTTGAATCACGTCAACAGGGATGTG
GAA
AACAATGGGAAGAAGAGCGGTCCTACAAAAGTTTACTTCTACTGGGTGACTAGAGAGCAGGGATCTTTCGAATGGTTTAAAGGTGTCATGAACGAGATTGCAGAGATGGATCACAAG
AGAGTTATCGAGATGCACAACTATCTCACGAGTGTGTACGAGGAGGGCGACGCTCGATCGGCACTGATCACCATGATCCAGGCTTTGAACCTGGCCAAAAACGGAGTGGACATCTTGTCT
GGAACTCGG
GTAAGAACACATTTTGCGAGACCAAACTGGAAGACGGTGTTTTCACGGCTCTCAGCAGTTCACAGGCATGCTAACATCGGCGTATTTTACTGTGGTGCCCCAGCAGTGGCG
AAAGAATTGGACACACTGTCGCGAGAGTACACGCACCAGAACTCAACCACCTTCGATTTTCACAAGGAAAACTTCTAA

Retrieve as FASTA