Entry information : SmRboh09-2_83 (SmRboh09b_83)
Entry ID 7393
Creation 0000-00-00 (Christophe Dunand)
Last sequence changes 2011-02-23 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-02-23 (Christophe Dunand)
Peroxidase information: SmRboh09-2_83 (SmRboh09b_83)
Name (synonym) SmRboh09-2_83 (SmRboh09b_83)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmRboh09-2_83
start..stop
S start..stop
SmRboh09-1_82 1470 0 1..707 119..825
SmRboh02-2_137 939 0 2..707 186..902
SmRboh02-1_19 936 0 2..707 179..895
SmRboh05-1_24 894 0 2..707 190..901
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 597481..597638 158 N° 2 597374..597422 49 N° 3 597176..597289 114 N° 4 596681..597106 426
N° 5 596232..596618 387 N° 6 596051..596146 96 N° 7 595872..595987 116 N° 8 595694..595796 103
N° 9 595558..595643 86 N° 10 595343..595496 154 N° 11 595168..595284 117 N° 12 594983..595111 129
N° 13 594845..594923 79 N° 14 594640..594749 110  
complement(join(594640..594749,594845..594923,594983..595111,595168..595284,5953 43..595496,595558..595643,595694..595796,595872..595987,596051..596146,596232..5 96618,596681..597106,597176..597289,597374..597422,597481..597638))


exon

Literature and cross-references SmRboh09-2_83 (SmRboh09b_83)
DNA ref. Phytozome 11:   scaffold_83 (597638..594640)
mRNA ref. JGI transcript:   158957 [Incorrect prediction]
Cluster/Prediction ref. UniGene:   Smo.5494
Protein sequence: SmRboh09-2_83 (SmRboh09b_83)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   707
PWM (Da):   %s   80734.59 Transmb domain:   %s   o166-188i304-326o353-375i534-551o
PI (pH):   %s   9.61
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
METSEFAQALFDALVSSKKLENQKSISKEVLHAFWLQMSDDSFDSRMQIFFQMFDRNADGHISEEEVKIIMLSAATNKLAKLKAQADEFAALIMEELDPDKNGFIELSQLEALMRVPEPAHAKDSFLNYSTTISRNLVAVKRKKHTPLLSFWKDSKFYLSENWRYLMFFGLWIATMAGLFAWKFFVYKQRAAFEVMGYCLCVAKGAAETLKLNMALVLFPVCRNTITWFRSTFVGNIVPFNDNLKFHMMIASGVAIGTVIHAGVHLACDFPRITSSSDELFMRTLGKSFHYKRQTYVDLLKSVAGVTGIASVLLMAFIFLLATPWFRRGQVKPLWPLHRLSGFNAFWYSHHLFIFVYVLLIVHSLFIYLAHGWWQKTTWMYVAIPVALYASERLVRAIRAGLYTVRVVKAAVYPGNVLALYIQKPRGFKYKSGMYLFLKCPAISHLQWHPFSITSAPSDDYLSIHIRSAGDWTSKMKKIFSVCHKPEVGKSGLLRAEYVDHDLEFQSQPRFPKLRIDGPYGAPAQDYMKYDVLLLVGLGIGATPFVSILRDILNHVNRDVNNGKKSGPTKVYFYWVTREQGSFEWFKGVMNEIAEMDHKRVIEMHNYLTSVYEEGDARSALITMIQALNLAKNGVDILSGTRVRTHFARPNWKTVFSRLSAVHRHANIGVFYCGAPGVAKELDALSREYTHQNSTTFDFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic and ESTs
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGACCTCGGAATTTGCTCAAGCGCTCTTCGATGCGCTCGTCTCCAGCAAGAAACTCGAGAACCAGAAAAGCATTTCCAAAGAAGTTCTTCACGCCTTCTGGCTGCAAATGAGCGAC
GATAGCTTCGACTCTCGTATGCAAATTTTCTTCCAGAT
GTAAGTTCTCGATTGTGATCAAGATGCAGTGATTTCGAATCGTTTCCTCGTTTCTCAGGTTCGACAGAAACGCAGACGGACA
TATATCAGAAGAAGAAGTCAAAGAG
GTGATTGATTGAGAGTGAGTGACAACCATCTTGCTCTTCTCTTAACTCTTTTTTTTTTTTCCTTGGTGCGGCACAATCGTGTAGATTATCATGCT
TAGTGCGGCAACCAACAAGCTTGCCAAGCTCAAGGCACAAGCCGACGAGTTCGCCGCGTTAATTATGGAAGAGTTGGATCCTGACAAGAATGGCTTCATTGAG
GTAAATATTTCCACGAT
GCCATGATCGAGCTTCATAGTTTTCCTTGTCCACTTTTCTTTTTCCTGGCAGCTTTCGCAGCTCGAAGCTTTGATGAGAGTTCCGGAGCCAGCGCATGCCAAAGACTCTTTCCTCAACTA
CAGCACAACCATCTCTCGGAATCTCGTCGCCGTCAAGCGGAAAAAGCACACTCCACTTCTCTCCTTTTGGAAAGATTCGAAGTTCTACCTCTCCGAGAACTGGAGGTACCTCATGTTCTT
CGGACTTTGGATTGCGACCATGGCGGGATTGTTCGCGTGGAAGTTTTTCGTGTACAAGCAGCGAGCAGCTTTTGAAGTCATGGGATATTGTCTGTGCGTCGCAAAAGGTGCTGCCGAGAC
TCTCAAGCTCAACATGGCACTCGTGCTTTTCCCGGTCTGTAGAAACACCATCACCTGGTTTCGTTCGACCTTCGTCGGCAACATCGTCCCTTTCAACGACAACCTCAAGTTTCATATG
GT
ACGTACAACCTTTGATCTTTTGCTTTCGTCTTCTTCTTCTGATAGTTCTTTTTCGTCCAGATGATTGCGTCTGGTGTTGCAATTGGAACTGTGATTCACGCTGGAGTCCACTTGGCCTGC
GACTTCCCGAGAATTACTAGCTCGTCTGACGAGCTCTTCATGCGCACCCTCGGCAAAAGTTTTCACTACAAGAGACAAACGTACGTTGATCTGCTAAAGTCAGTGGCTGGGGTTACTGGG
ATCGCGAGCGTGCTGCTCATGGCTTTTATATTCCTGCTAGCGACGCCATGGTTCAGGCGAGGCCAGGTAAAGCCACTGTGGCCTTTGCACAGGCTAAGCGGATTCAACGCCTTTTGGTAC
TCGCACCATTTGTTTATCTTTGTCTACGTCCTGCTCATTGTCCACTCGCTCTTCATTTATTTGGCACATGGATGGTGGCAGAAAACG
GTTCGTAAGTGGCTCCTTTGGTCTTTGAGACTT
GTTTTTCCACTGACGAGTTTTCTCTTTTCTCTCGTTTTGGTTTCCTGCACAGACTTGGATGTATGTCGCGATTCCAGTGGCTTTATATGCCTCCGAGCGATTGGTACGAGCCATCCGTGC
GGGATTGTATACAGTTCGTGTAGTCAAG
GTCTGGCACGAAACTTTTCTTTAGGATTTCGTTCATGGTTTTGATTGAGCAGTTTAACTACAGGCTGCTGTTTATCCTGGAAATGTCTTGGC
TTTGTACATACAAAAGCCTCGCGGTTTTAAGTACAAGAGTGGCATGTATCTCTTCCTCAAGTGCCCGGCCATCTCGCATCTTCAATG
GTCAGTACTACTAGTTTCTTAGCTTTTTTTTTC
TTTCTTTTCTTTAGTCAGCAAGCTTTGATCTTTTCATCACAGGCATCCTTTTTCGATCACTTCTGCTCCAAGTGATGACTACTTGAGCATCCATATAAGAAGTGCCGGGGACTGGACCTC
CAAAATGAAGAAAATCTTCTCAGAG
GTACGTATGCTGCCATACATTTGAACTCCAACTTTGAAAGCCGTGTACAGGTTTGCCACAAACCCGAAGTTGGCAAAAGTGGCCTGCTCAGAGCT
GAGTATGTGGATCATGATCTGGAGTTCCAGTCACAACCAAG
GTAGGAAAAATAGATTAGAATTTTACAGAAAAGCTGTGCCTTTTTTTTTCGTCTATTGCAGGTTTCCAAAGCTACGAAT
TGATGGTCCCTATGGTGCTCCAGCACAAGATTACATGAAGTATGATGTGCTGCTGCTCGTTGGTCTTGGCATTGGAGCAACACCTTTCGTAAGTATTCTGAGAGACATCTTGAATCACGT
CAACAGGGATGTGGAA
GTAAGTTCTTCCAAGTTACTCAAGCTACAAACTCATTCTCATTCCGTTGGGATCGCAGAACAATGGGAAGAAGAGCGGTCCTACAAAAGTTTACTTCTACTGGG
TGACTAGAGAGCAGGGATCTTTCGAATGGTTTAAAGGTGTCATGAACGAGATTGCAGAGATGGATCACAAG
GTCGGATTTTTCTCGCATTCTTTTGCTTAATAGTTTGCATGAACTTTGA
CGAGCAGAGAGTTATCGAGATGCACAACTATCTCACGAGTGTGTACGAGGAGGGCGACGCTCGATCGGCACTGATCACCATGATCCAGGCTTTGAACCTCGCCAAAAACGGAGTGGACAT
CCTGTCTGGGACTCGG
GTACGTACGAAGATTTCTTCTAGTTCCTGTAGTTTCTAAAAACTGTCGCTCCTCTCCAGGTAAGAACACATTTTGCGAGACCAAACTGGAAGACGGTGTTTTCA
CGGCTCTCAGCAGTTCACAGGCATGCTAACATCG
GTGAGTGATGGATTCTCAAGACAAAACTTTGGTCTAGCATCTAGAAAAGAAAAAAGGAGCCATCACTCCCGTTTTCCACGTTTTGT
TCCTTGCAGGCGTATTTTACTGTGGTGCCCCAGGAGTGGCGAAAGAATTGGACGCACTGTCGCGAGAGTACACGCACCAGAACTCAACCACCTTCGATTTTCACAAGGAAAACTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGACCTCGGAATTTGCTCAAGCGCTCTTCGATGCGCTCGTCTCCAGCAAGAAACTCGAGAACCAGAAAAGCATTTCCAAAGAAGTTCTTCACGCCTTCTGGCTGCAAATGAGCGAC
GATAGCTTCGACTCTCGTATGCAAATTTTCTTCCAGAT
GTTCGACAGAAACGCAGACGGACATATATCAGAAGAAGAAGTCAAAGAGATTATCATGCTTAGTGCGGCAACCAACAAGCTT
GCCAAGCTCAAGGCACAAGCCGACGAGTTCGCCGCGTTAATTATGGAAGAGTTGGATCCTGACAAGAATGGCTTCATTGAG
CTTTCGCAGCTCGAAGCTTTGATGAGAGTTCCGGAGCCA
GCGCATGCCAAAGACTCTTTCCTCAACTACAGCACAACCATCTCTCGGAATCTCGTCGCCGTCAAGCGGAAAAAGCACACTCCACTTCTCTCCTTTTGGAAAGATTCGAAGTTCTACCTC
TCCGAGAACTGGAGGTACCTCATGTTCTTCGGACTTTGGATTGCGACCATGGCGGGATTGTTCGCGTGGAAGTTTTTCGTGTACAAGCAGCGAGCAGCTTTTGAAGTCATGGGATATTGT
CTGTGCGTCGCAAAAGGTGCTGCCGAGACTCTCAAGCTCAACATGGCACTCGTGCTTTTCCCGGTCTGTAGAAACACCATCACCTGGTTTCGTTCGACCTTCGTCGGCAACATCGTCCCT
TTCAACGACAACCTCAAGTTTCATATG
ATGATTGCGTCTGGTGTTGCAATTGGAACTGTGATTCACGCTGGAGTCCACTTGGCCTGCGACTTCCCGAGAATTACTAGCTCGTCTGACGAG
CTCTTCATGCGCACCCTCGGCAAAAGTTTTCACTACAAGAGACAAACGTACGTTGATCTGCTAAAGTCAGTGGCTGGGGTTACTGGGATCGCGAGCGTGCTGCTCATGGCTTTTATATTC
CTGCTAGCGACGCCATGGTTCAGGCGAGGCCAGGTAAAGCCACTGTGGCCTTTGCACAGGCTAAGCGGATTCAACGCCTTTTGGTACTCGCACCATTTGTTTATCTTTGTCTACGTCCTG
CTCATTGTCCACTCGCTCTTCATTTATTTGGCACATGGATGGTGGCAGAAAACG
ACTTGGATGTATGTCGCGATTCCAGTGGCTTTATATGCCTCCGAGCGATTGGTACGAGCCATCCGT
GCGGGATTGTATACAGTTCGTGTAGTCAAG
GCTGCTGTTTATCCTGGAAATGTCTTGGCTTTGTACATACAAAAGCCTCGCGGTTTTAAGTACAAGAGTGGCATGTATCTCTTCCTCAAG
TGCCCGGCCATCTCGCATCTTCAATG
GCATCCTTTTTCGATCACTTCTGCTCCAAGTGATGACTACTTGAGCATCCATATAAGAAGTGCCGGGGACTGGACCTCCAAAATGAAGAAAATC
TTCTCAGAG
GTTTGCCACAAACCCGAAGTTGGCAAAAGTGGCCTGCTCAGAGCTGAGTATGTGGATCATGATCTGGAGTTCCAGTCACAACCAAGGTTTCCAAAGCTACGAATTGATGGT
CCCTATGGTGCTCCAGCACAAGATTACATGAAGTATGATGTGCTGCTGCTCGTTGGTCTTGGCATTGGAGCAACACCTTTCGTAAGTATTCTGAGAGACATCTTGAATCACGTCAACAGG
GATGTGGAA
AACAATGGGAAGAAGAGCGGTCCTACAAAAGTTTACTTCTACTGGGTGACTAGAGAGCAGGGATCTTTCGAATGGTTTAAAGGTGTCATGAACGAGATTGCAGAGATGGAT
CACAAG
AGAGTTATCGAGATGCACAACTATCTCACGAGTGTGTACGAGGAGGGCGACGCTCGATCGGCACTGATCACCATGATCCAGGCTTTGAACCTCGCCAAAAACGGAGTGGACATC
CTGTCTGGGACTCGG
GTAAGAACACATTTTGCGAGACCAAACTGGAAGACGGTGTTTTCACGGCTCTCAGCAGTTCACAGGCATGCTAACATCGGCGTATTTTACTGTGGTGCCCCAGGA
GTGGCGAAAGAATTGGACGCACTGTCGCGAGAGTACACGCACCAGAACTCAACCACCTTCGATTTTCACAAGGAAAACTTCTAA

Retrieve as FASTA