Entry information : SmRboh08-1_4 (SmRboh08a_4)
Entry ID 7396
Creation 0000-00-00 (Christophe Dunand)
Last sequence changes 2010-06-01 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmRboh08-1_4 (SmRboh08a_4)
Name (synonym) SmRboh08-1_4 (SmRboh08a_4)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmRboh08-1_4
start..stop
S start..stop
SmRboh08-2_91 1445 0 1..723 1..706
SmRboh02-1_19 982 0 1..723 177..895
SmRboh02-2_137 981 0 1..723 184..902
PabRboh126 905 0 1..723 206..942
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2895390..2895556 167 N° 2 2895288..2895336 49 N° 3 2895106..2895219 114 N° 4 2894432..2894821 390
N° 5 2893996..2894385 390 N° 6 2893826..2893921 96 N° 7 2893663..2893778 116 N° 8 2893475..2893577 103
N° 9 2893151..2893423 273 N° 10 2892949..2893104 156 N° 11 2892769..2892897 129 N° 12 2892637..2892715 79
N° 13 2892474..2892583 110  
complement(join(2892474..2892583,2892637..2892715,2892769..2892897,2892949..2893 104,2893151..2893423,2893475..2893577,2893663..2893778,2893826..2893921,2893996. .2894385,2894432..2894821,2895106..2895219,2895288..2895336,2895390..2895556))


exon

Literature and cross-references SmRboh08-1_4 (SmRboh08a_4)
DNA ref. Phytozome 11:   scaffold_4 (2895556..2892474)
EST ref. GenBank:   FE433447.1 [5' end]   FE427406.1 [3' end]
Protein sequence: SmRboh08-1_4 (SmRboh08a_4)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   723
PWM (Da):   %s   82475.49 Transmb domain:   %s   o154-176i236-258o295-317i338-360o370-389i536-553o
PI (pH):   %s   8.81
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQDSKEFAGELFDALARRKLKHRQRVEWISYDELRDFWLQISDQNFDSRMQIFFDMCDKDLDGLISEAEVKVIMLSASENKLSKLKERAEEYAAMIMEELDPQRRGYIELWQLESLIQGTTGIGNYGQILVQPRMFCGSGLVRGICYVFIEHWQRLWVLGLWLLAVVCLFSWKFVQYKNQSSFLVAGYCICVAKGAAETLKLNMALILLPVCRNSITWLRSTSAVGSLIPFDDNINFHKIIGGAIFLGVVLHGGVHLTCDFPRLANSPREQFMAAGLAGDFGNRQPTYWELVKSIEGVTGIAMVLIMCVAFVLASGRSRRNLVKLPWPLHRLTGFNAFWYSHHLFIIVYTMLVLHSMFLFLKHDWVDKTAWMYLLLPTLLYMFERTFSGLRAGYSTVQILKAAIYPGNVLSLDMTKPPGFKYQSGMYIFIKCPSISPFEWHPFSITSAPSDDFVSVHIRISGDWTGEMGKIFSVCEPPVGNKSGPLKAEYLFGLQSRFVLKLDVSPYFRWNRFPKLLIDGPYGAPAQDYKKYDVLLLIGLGIGATPFISILKDILNNIKTTEPKVRRSEMKPLKKESSFRKINGPCNAYFYWLTKEQGSFEWFRGVMNEIAELDHSALIEMHNYLTSVYAEDDARSALITMVQALHLEKNGVDILSGTRVRTHFAKPNWRKVFGNLASLHPNARIGVFFCGSKILARELDSLAREYSHNQATKFDFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic and 1 EST. Uncorrect predict from JGI.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAAGACTCTAAAGAGTTTGCCGGGGAGCTCTTCGATGCCTTGGCGCGGCGCAAGCTCAAGCATCGGCAGCGCGTGGAATGGATCAGCTACGACGAGCTCAGGGATTTTTGGCTCCAG
ATTTCGGACCAGAATTTCGACTCGAGGATGCAAATCTTCTTCGACAT
GTAAGCCATTTCTTCTTCTCTTCGATCATCTCCTGGATATCCTTGCGATCTAGGTGTGACAAGGATCTGGATG
GACTCATCTCCGAGGCGGAGGTGAAGGAG
GTAACAAAGATCGATCAATTGGTGAGCGGTGGCGGTGACGTCCTCGTCCTTTGTTTGCGATTTTGTAGGTCATCATGCTGAGCGCGTCCGA
GAACAAGCTGTCCAAGCTCAAGGAGCGTGCCGAGGAGTACGCTGCGATGATCATGGAAGAGCTGGACCCCCAGCGAAGAGGCTACATTGAG
GTACTCCATTCCTTCTCCTGCTAGCAGCT
AGCATTGGACTTCTCTTTCGTCGTCCATGGCTTTCTTTTTATTTTTAACGAATTTTTTGCCCATCCCATGCATTGCATCACAGCTCTCACAGTTTTGGACTGATTCATTCATTCAGTCGC
CTTTGGAGCCAGAATAGTCATGCATGACAAACAAATTTCCAGCTGAGCTTGCACTCTTTCCATCACTTTGTTCCTCTTTTCCAAAAAAGTGGTGTACGTTTTCTCATGGGATTGTCTTTC
CTGCTTGACGTGCAGCTTTGGCAGCTCGAGAGTCTGATCCAAGGGACGACCGGAATCGGAAACTACGGCCAGATTTTGGTGCAGCCGAGGATGTTTTGTGGCAGCGGCTTGGTACGCGGC
ATTTGCTACGTATTCATCGAGCACTGGCAGCGACTGTGGGTGCTGGGCTTGTGGCTTTTGGCCGTGGTGTGCCTGTTTTCCTGGAAGTTCGTGCAGTACAAGAACCAGTCGTCGTTTCTG
GTTGCCGGGTACTGCATATGCGTCGCCAAAGGCGCCGCTGAGACGCTCAAGCTCAACATGGCTCTCATCCTTCTCCCGGTTTGTAGGAATTCCATCACTTGGCTGAGGTCCACAAGCGCC
GTGGGATCTCTTATTCCTTTTGATGACAACATCAACTTCCACAAG
GCAAGTTGGTAATCTTTTTCCCGTGTTCTCAACATCGTGGTTACAGATAATCGGGGGAGCAATCTTCCTTGGAGT
CGTTCTTCACGGCGGAGTTCATCTCACCTGTGACTTTCCGAGGCTGGCGAATTCCCCTCGCGAGCAGTTCATGGCCGCTGGACTCGCTGGGGACTTTGGAAACAGGCAACCTACGTACTG
GGAGCTCGTAAAATCGATCGAAGGCGTTACAGGCATTGCCATGGTCCTCATTATGTGCGTCGCCTTCGTTCTAGCATCAGGACGCTCGCGGAGAAACCTGGTGAAGCTCCCGTGGCCGTT
ACACAGATTGACTGGCTTCAACGCCTTTTGGTACTCCCACCATCTGTTCATCATTGTCTACACGATGCTCGTCTTACATTCCATGTTCCTGTTCTTAAAGCACGACTGGGTCGACAAAAC
A
GTAAGTAATGTTTCCCTTCCTTTACTTTGTTTTTCTTTGGCATTTTGCAGTTCTTAATTCTTTCGTTCTTTCAGGCATGGATGTATCTTCTTCTTCCAACACTGCTGTACATGTTCGAG
CGAACGTTTTCCGGTCTGCGAGCAGGATACTCCACTGTTCAAATCCTAAAG
GTTGTATAATTCTGGCAGTTTAGTGATCATAATTTTCGTCTTCTCAGGCGGCAATCTATCCTGGAAACG
TTTTGTCTTTGGACATGACCAAGCCTCCAGGATTTAAGTACCAAAGTGGTATGTATATATTCATCAAGTGCCCATCGATATCACCTTTCGAATG
GTATCGTTTGTGCTCCCACGTTCTAC
ATTAAAAAACGTTCTAACTTTATTAGCGTTGACTGATTGGCGTCTCTGGTTGTCTGCAGGCATCCTTTCTCCATCACCTCCGCACCGAGCGATGATTTTGTCAGTGTTCATATTCGGATA
TCGGGAGATTGGACTGGGGAAATGGGAAAAATTTTCTCCAAG
GTACTTTAAATCGGACAGTTTTCTGGTGGTAATTGACTTGGAACTACACAGGTTTGCGAACCTCCAGTTGGCAACAAG
AGCGGGCCTTTGAAAGCGGAGTATCTCTTTGGACTTCAGTCACGGTTTGTGTTAAAACTTGATGTTAGTCCTTACTTTCGTTGGAACAGGTTTCCTAAACTGCTGATTGATGGTCCTTAC
GGAGCTCCGGCTCAGGACTACAAGAAATATGACGTGCTTCTTCTCATCGGTCTTGGAATAGGAGCAACACCTTTCATCAGTATTTTGAAGGACATACTGAATAACATCAAAACAACTGAG
CCCAAG
GTATGAGATTTAATGAAAGATCATCCATTTCCTTACCATTGTCTAGGTGCGAAGAAGTGAGATGAAACCTCTGAAAAAGGAATCGTCATTCAGAAAGATTAACGGCCCATGCAA
CGCGTATTTTTACTGGCTTACAAAAGAGCAAGGCTCATTTGAGTGGTTCAGAGGCGTCATGAACGAAATTGCTGAGCTTGACCATTCG
GTATGTTGTAAACGTCCCTCATATTCTAGACG
TTGACAAATGCAAGCACAGGCATTGATTGAAATGCACAACTATTTAACTAGTGTCTATGCCGAGGACGATGCGAGATCAGCTCTCATAACAATGGTGCAAGCTTTGCACCTTGAGAAAAA
CGGAGTAGACATCCTCTCTGGAACTCGA
GTAAAACCAAAAGTTTTATTTATCTCATTTTGGAACTAATCGATGATCAACAGGTCAGGACACATTTTGCAAAACCGAACTGGAGAAAAGTT
TTTGGCAACTTAGCATCACTTCATCCAAACGCTCGGATAG
GTAACACGCAAAGATAGTCCTCTTGAAGGTTGCTCATTAAGTTTGTTCTTCAGGAGTTTTCTTTTGTGGATCTAAAATTC
TCGCACGGGAACTTGATAGCCTAGCACGAGAATACTCACACAACCAAGCCACCAAGTTCGACTTCCATAAGGAGAACTTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAAGACTCTAAAGAGTTTGCCGGGGAGCTCTTCGATGCCTTGGCGCGGCGCAAGCTCAAGCATCGGCAGCGCGTGGAATGGATCAGCTACGACGAGCTCAGGGATTTTTGGCTCCAG
ATTTCGGACCAGAATTTCGACTCGAGGATGCAAATCTTCTTCGACAT
GTGTGACAAGGATCTGGATGGACTCATCTCCGAGGCGGAGGTGAAGGAGGTCATCATGCTGAGCGCGTCCGAG
AACAAGCTGTCCAAGCTCAAGGAGCGTGCCGAGGAGTACGCTGCGATGATCATGGAAGAGCTGGACCCCCAGCGAAGAGGCTACATTGAG
CTTTGGCAGCTCGAGAGTCTGATCCAAGGG
ACGACCGGAATCGGAAACTACGGCCAGATTTTGGTGCAGCCGAGGATGTTTTGTGGCAGCGGCTTGGTACGCGGCATTTGCTACGTATTCATCGAGCACTGGCAGCGACTGTGGGTGCTG
GGCTTGTGGCTTTTGGCCGTGGTGTGCCTGTTTTCCTGGAAGTTCGTGCAGTACAAGAACCAGTCGTCGTTTCTGGTTGCCGGGTACTGCATATGCGTCGCCAAAGGCGCCGCTGAGACG
CTCAAGCTCAACATGGCTCTCATCCTTCTCCCGGTTTGTAGGAATTCCATCACTTGGCTGAGGTCCACAAGCGCCGTGGGATCTCTTATTCCTTTTGATGACAACATCAACTTCCACAAG
ATAATCGGGGGAGCAATCTTCCTTGGAGTCGTTCTTCACGGCGGAGTTCATCTCACCTGTGACTTTCCGAGGCTGGCGAATTCCCCTCGCGAGCAGTTCATGGCCGCTGGACTCGCTGGG
GACTTTGGAAACAGGCAACCTACGTACTGGGAGCTCGTAAAATCGATCGAAGGCGTTACAGGCATTGCCATGGTCCTCATTATGTGCGTCGCCTTCGTTCTAGCATCAGGACGCTCGCGG
AGAAACCTGGTGAAGCTCCCGTGGCCGTTACACAGATTGACTGGCTTCAACGCCTTTTGGTACTCCCACCATCTGTTCATCATTGTCTACACGATGCTCGTCTTACATTCCATGTTCCTG
TTCTTAAAGCACGACTGGGTCGACAAAACA
GCATGGATGTATCTTCTTCTTCCAACACTGCTGTACATGTTCGAGCGAACGTTTTCCGGTCTGCGAGCAGGATACTCCACTGTTCAAATC
CTAAAG
GCGGCAATCTATCCTGGAAACGTTTTGTCTTTGGACATGACCAAGCCTCCAGGATTTAAGTACCAAAGTGGTATGTATATATTCATCAAGTGCCCATCGATATCACCTTTCGAA
TG
GCATCCTTTCTCCATCACCTCCGCACCGAGCGATGATTTTGTCAGTGTTCATATTCGGATATCGGGAGATTGGACTGGGGAAATGGGAAAAATTTTCTCCAAGGTTTGCGAACCTCCA
GTTGGCAACAAGAGCGGGCCTTTGAAAGCGGAGTATCTCTTTGGACTTCAGTCACGGTTTGTGTTAAAACTTGATGTTAGTCCTTACTTTCGTTGGAACAGGTTTCCTAAACTGCTGATT
GATGGTCCTTACGGAGCTCCGGCTCAGGACTACAAGAAATATGACGTGCTTCTTCTCATCGGTCTTGGAATAGGAGCAACACCTTTCATCAGTATTTTGAAGGACATACTGAATAACATC
AAAACAACTGAGCCCAAG
GTGCGAAGAAGTGAGATGAAACCTCTGAAAAAGGAATCGTCATTCAGAAAGATTAACGGCCCATGCAACGCGTATTTTTACTGGCTTACAAAAGAGCAAGGC
TCATTTGAGTGGTTCAGAGGCGTCATGAACGAAATTGCTGAGCTTGACCATTCG
GCATTGATTGAAATGCACAACTATTTAACTAGTGTCTATGCCGAGGACGATGCGAGATCAGCTCTC
ATAACAATGGTGCAAGCTTTGCACCTTGAGAAAAACGGAGTAGACATCCTCTCTGGAACTCGA
GTCAGGACACATTTTGCAAAACCGAACTGGAGAAAAGTTTTTGGCAACTTAGCATCA
CTTCATCCAAACGCTCGGATAG
GAGTTTTCTTTTGTGGATCTAAAATTCTCGCACGGGAACTTGATAGCCTAGCACGAGAATACTCACACAACCAAGCCACCAAGTTCGACTTCCATAAG
GAGAACTTTTGA

Retrieve as FASTA