Entry information : SmRboh08-2_91 (SmRboh08b_91)
Entry ID 7397
Creation 0000-00-00 (Christophe Dunand)
Last sequence changes 2010-06-01 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmRboh08-2_91 (SmRboh08b_91)
Name (synonym) SmRboh08-2_91 (SmRboh08b_91)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmRboh08-2_91
start..stop
S start..stop
SmRboh08-1_4 1445 0 1..706 1..723
SmRboh02-1_19 983 0 1..706 177..895
SmRboh02-2_137 981 0 1..706 184..902
CsRboh01 917 0 1..706 220..946
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 390846..391012 167 N° 2 391066..391114 49 N° 3 391183..391296 114 N° 4 391588..391977 390
N° 5 392024..392413 390 N° 6 392489..392584 96 N° 7 392632..392747 116 N° 8 392833..392935 103
N° 9 392987..393051 65 N° 10 393103..393259 157 N° 11 393306..393461 156 N° 12 393513..393641 129
N° 13 393695..393773 79 N° 14 393826..393935 110  
join(390846..391012,391066..391114,391183..391296,391588..391977,392024..392413, 392489..392584,392632..392747,392833..392935,392987..393051,393103..393259,39330 6..393461,393513..393641,393695..393773,393826..393935)


exon

Literature and cross-references SmRboh08-2_91 (SmRboh08b_91)
DNA ref. Phytozome 11:   scaffold_91 (390846..393935)
mRNA ref. JGI transcript:   128789 [Incorrect splicing]
EST ref. GenBank:   FE427406.1 [3' end]   FE447477.1 [Fragment]
Cluster/Prediction ref. UniGene:   Smo.1644
Protein sequence: SmRboh08-2_91 (SmRboh08b_91)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   706
PWM (Da):   %s   80304.36 Transmb domain:   %s   o154-176i236-258o295-317i338-360o370-389i519-536o
PI (pH):   %s   8.39
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQDSKEFAGELFDALARRKLKHRQRVEWISYDELRDFWLQISDQNFDSRMQIFFDMCDKDLDGLISEAEVKVIMLSASENKLSKLKERAEEYAAMIMEELDPQRRGYIELWQLESLIQGTTGIGNYGQILVQPRMFCGSGLIRGICYVLIEHWQRLWVLGLWLLAVVCLFSWKFVQYKNQSSFLVAGYCICVAKGAAETLKLNMALILLPVCRNSITWLRSTSVVGSLIPFDDNINFHKIIGGAIFIGVVLHGGVHLTCDFPRLANSPREQFMAAGLAGDFGNRQPTYWELVKSIEGVTGIAMVLIMCVAFVLASGRSRRNLVKLPWPLHRLTGFNAFWYSHHLFIIVYTMLVLHSMFLFLKHDWVDKTAWMYLLLPTLLYMFERTFSGLRAGYSTVQILKAAIYPGNVLSLDMTKPPGFKYQSGMYIFIKCPSISPFEWHPFSITSAPSDDFVSVHIRISGDWTGEMGKIFSVCEPPVGNKSGPLKAEYLFGLQFPKLLIDGPYGAPAQDYKKYDVLLLIGLGIGATPFISILKDILNNIKTTEPVRRSEMKPLKKESSFRKINGPSNAYFYWLTKEQGSFEWFRGVMNEIAELDHSALIEMHNYLTSVYAEDDARSALITMVQALHLEKNGVDILSGTRVRTHFAKPNWRKVFGNLASLHPNARIGVFFCGSKILARELDSLAREYSHNQATKFDFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic and ESTs. Incorrect prediction from JGI (splicing error).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAAGATTCTAAAGAGTTTGCCGGGGAGCTCTTCGATGCCTTGGCGCGGCGCAAGCTCAAGCATCGGCAGCGCGTGGAATGGATCAGCTACGACGAGCTCAGGGATTTCTGGCTCCAG
ATTTCGGACCAGAATTTCGACTCGAGGATGCAAATCTTCTTCGACAT
GTAAGCCATTTCTTCTTCTCTTCGATCATCTCCTGGATATCCTTGCGATCTAGGTGTGACAAGGATCTGGATG
GACTCATCTCCGAGGCGGAGGTGAAGGAG
GTAACAGAGATCGATCGATTGGTGAGCGGTGGTGGTGACGTCCTCGTCCTTTGTTTGCGATTTTATAGGTCATCATGCTGAGCGCGTCCGA
GAACAAGCTGTCCAAGCTCAAGGAGCGTGCCGAGGAGTACGCTGCGATGATCATGGAAGAGCTGGACCCCCAGCGAAGAGGCTACATTGAG
GTACTCCATTCCTTCTCCTGCTAGCAGCT
AGCATTGGACTTCTCTTTCGTCGTCCATGGTTTCTTTTTTCATTTTTAACGAATTTTTTGCCCATGCCATGCATTGCATCACAGCTCTCACAGTTTTGGACTGATTCATTCATTCAGTCG
CCTTTGGAGGCAGAATAGTCATGCATGACAAACAAATTTCCAGCTGAGCTTGCACTCTTTTCTTTTCCATCACTTTGTTCCTCTTTTCCAAAAAAGTGGTGTACGTTTTCTCATGGGATT
GTCTTTCCTGCTTGACGTGCAGCTTTGGCAGCTCGAGAGTCTGATCCAAGGGACGACCGGAATCGGAAACTACGGCCAGATTTTGGTGCAGCCGAGGATGTTTTGTGGCAGCGGCTTGAT
ACGCGGCATCTGCTACGTACTCATCGAGCACTGGCAGCGACTGTGGGTGCTGGGCTTGTGGCTTTTGGCGGTGGTGTGCCTGTTTTCCTGGAAGTTCGTCCAGTACAAGAACCAGTCGTC
GTTTCTGGTTGCCGGGTACTGCATATGCGTCGCCAAAGGCGCCGCTGAGACGCTCAAGCTCAACATGGCTCTCATCCTTCTCCCGGTTTGTAGGAATTCCATCACTTGGCTGAGGTCCAC
AAGCGTCGTGGGATCTCTTATTCCTTTTGATGACAACATCAACTTCCACAAG
GCAAGTTGGTAATCTTTTTCCCGTGTTCTCAACATCGTGGTTACAGATAATCGGGGGAGCAATCTTCA
TTGGAGTCGTTCTTCACGGCGGAGTTCATCTCACCTGCGACTTTCCGAGGCTGGCGAATTCCCCTCGCGAGCAGTTCATGGCCGCTGGACTCGCTGGGGACTTTGGAAACAGGCAACCTA
CGTACTGGGAGCTCGTAAAATCGATCGAAGGCGTTACAGGCATTGCCATGGTCCTCATTATGTGCGTCGCCTTCGTTCTAGCATCAGGACGCTCGCGGAGAAACCTGGTGAAGCTCCCGT
GGCCGTTACACAGATTGACTGGCTTCAACGCCTTTTGGTACTCCCACCATCTGTTCATCATTGTCTACACGATGCTCGTCTTACATTCCATGTTCCTGTTCTTAAAGCACGACTGGGTCG
ATAAAACA
GTAAGTAATGTTTCCCTTCCTTTCCTTTTGTTTTTCTTTGGCATTTTGCAGTTCTTAATTCTTTCGTTCTTTTAGGCATGGATGTATCTTCTTCTTCCAACACTGCTGTACA
TGTTCGAGCGAACGTTTTCCGGTCTGCGAGCAGGATACTCCACTGTTCAAATCCTAAAG
GTTGTATAATTCTGGTAGTTTAGTGATCATAATTCTCGTCTTCTCAGGCGGCAATCTATCC
TGGAAACGTTTTGTCTTTGGACATGACCAAGCCTCCAGGATTTAAGTACCAAAGTGGTATGTATATATTCATCAAGTGCCCATCGATATCACCTTTCGAATG
GTATCGTTTGTGCTCCCA
CGTTCTACATTTAAAAACGTTCTAACTTTATTAGCGTTGACTGATTGGCGTCTCTGGTTGTCTGCAGGCATCCTTTCTCCATCACCTCCGCACCGAGCGATGATTTTGTCAGTGTTCATA
TTCGGATATCGGGAGATTGGACTGGGGAAATGGGAAAAATTTTCTCCGAG
GTACTTTAAATTGGACAGTTTTCTGGTGGTATGTGACATGGAACTACACAGGTTTGCGAACCTCCAGTTG
GCAACAAGAGCGGGCCTTTGAAAGCGGAGTACCTCTTTGGACTTCA
GTCACGGTTTGTGTTAAAACTTGACGTTAGTCCTTACTTTCGTTGGAACAGGTTTCCTAAACTGCTGATTGATG
GTCCTTACGGAGCTCCAGCTCAGGACTACAAGAAATATGACGTGCTTCTTCTCATCGGTCTTGGGATAGGAGCAACACCGTTCATCAGTATTTTGAAGGACATACTAAATAACATCAAAA
CAACTGAGCCCAAG
GTATGAGATTTAATGAAAGATCATCCATTTCCTTACCATTGTCTAGGTGCGAAGAAGTGAGATGAAACCTCTGAAAAAGGAATCGTCATTCAGAAAGATTAACGGC
CCATCCAACGCGTATTTTTACTGGCTTACAAAAGAGCAAGGCTCATTTGAGTGGTTCAGAGGCGTCATGAACGAAATTGCTGAGCTTGACCATTCG
GTATGTTTTAAACGTCCTTCATTT
TCTAGAAGCTGACAAATGCAAGCACAGGCATTGATTGAAATGCACAACTATTTAACTAGTGTTTATGCCGAGGACGATGCGAGATCAGCTCTCATAACAATGGTGCAAGCTTTGCACCTT
GAGAAAAACGGAGTAGACATCCTCTCTGGAACTCGA
GTAAAACCAAAAGTTTTCTTTATCTCATTTTGGAACTAATCGATGGTCAACAGGTCAGGACACATTTTGCAAAACCGAACTGGA
GAAAAGTTTTTGGCAACTTAGCATCACTTCATCCAAACGCTCGGATAG
GTACACGCAAAGATAGTGCTCTTGAAGGTTTCTCATTACGTTTGTTCTTCAGGAGTTTTCTTTTGTGGATCT
AAAATTCTCGCACGGGAACTTGATAGCCTAGCACGAGAATACTCGCACAACCAAGCCACCAAGTTCGACTTCCACAAGGAGAACTTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAAGATTCTAAAGAGTTTGCCGGGGAGCTCTTCGATGCCTTGGCGCGGCGCAAGCTCAAGCATCGGCAGCGCGTGGAATGGATCAGCTACGACGAGCTCAGGGATTTCTGGCTCCAG
ATTTCGGACCAGAATTTCGACTCGAGGATGCAAATCTTCTTCGACAT
GTGTGACAAGGATCTGGATGGACTCATCTCCGAGGCGGAGGTGAAGGAGGTCATCATGCTGAGCGCGTCCGAG
AACAAGCTGTCCAAGCTCAAGGAGCGTGCCGAGGAGTACGCTGCGATGATCATGGAAGAGCTGGACCCCCAGCGAAGAGGCTACATTGAG
CTTTGGCAGCTCGAGAGTCTGATCCAAGGG
ACGACCGGAATCGGAAACTACGGCCAGATTTTGGTGCAGCCGAGGATGTTTTGTGGCAGCGGCTTGATACGCGGCATCTGCTACGTACTCATCGAGCACTGGCAGCGACTGTGGGTGCTG
GGCTTGTGGCTTTTGGCGGTGGTGTGCCTGTTTTCCTGGAAGTTCGTCCAGTACAAGAACCAGTCGTCGTTTCTGGTTGCCGGGTACTGCATATGCGTCGCCAAAGGCGCCGCTGAGACG
CTCAAGCTCAACATGGCTCTCATCCTTCTCCCGGTTTGTAGGAATTCCATCACTTGGCTGAGGTCCACAAGCGTCGTGGGATCTCTTATTCCTTTTGATGACAACATCAACTTCCACAAG
ATAATCGGGGGAGCAATCTTCATTGGAGTCGTTCTTCACGGCGGAGTTCATCTCACCTGCGACTTTCCGAGGCTGGCGAATTCCCCTCGCGAGCAGTTCATGGCCGCTGGACTCGCTGGG
GACTTTGGAAACAGGCAACCTACGTACTGGGAGCTCGTAAAATCGATCGAAGGCGTTACAGGCATTGCCATGGTCCTCATTATGTGCGTCGCCTTCGTTCTAGCATCAGGACGCTCGCGG
AGAAACCTGGTGAAGCTCCCGTGGCCGTTACACAGATTGACTGGCTTCAACGCCTTTTGGTACTCCCACCATCTGTTCATCATTGTCTACACGATGCTCGTCTTACATTCCATGTTCCTG
TTCTTAAAGCACGACTGGGTCGATAAAACA
GCATGGATGTATCTTCTTCTTCCAACACTGCTGTACATGTTCGAGCGAACGTTTTCCGGTCTGCGAGCAGGATACTCCACTGTTCAAATC
CTAAAG
GCGGCAATCTATCCTGGAAACGTTTTGTCTTTGGACATGACCAAGCCTCCAGGATTTAAGTACCAAAGTGGTATGTATATATTCATCAAGTGCCCATCGATATCACCTTTCGAA
TG
GCATCCTTTCTCCATCACCTCCGCACCGAGCGATGATTTTGTCAGTGTTCATATTCGGATATCGGGAGATTGGACTGGGGAAATGGGAAAAATTTTCTCCGAGGTTTGCGAACCTCCA
GTTGGCAACAAGAGCGGGCCTTTGAAAGCGGAGTACCTCTTTGGACTTCA
GTTTCCTAAACTGCTGATTGATGGTCCTTACGGAGCTCCAGCTCAGGACTACAAGAAATATGACGTGCTT
CTTCTCATCGGTCTTGGGATAGGAGCAACACCGTTCATCAGTATTTTGAAGGACATACTAAATAACATCAAAACAACTGAGCCCAAG
GTGCGAAGAAGTGAGATGAAACCTCTGAAAAAG
GAATCGTCATTCAGAAAGATTAACGGCCCATCCAACGCGTATTTTTACTGGCTTACAAAAGAGCAAGGCTCATTTGAGTGGTTCAGAGGCGTCATGAACGAAATTGCTGAGCTTGACCAT
TCG
GCATTGATTGAAATGCACAACTATTTAACTAGTGTTTATGCCGAGGACGATGCGAGATCAGCTCTCATAACAATGGTGCAAGCTTTGCACCTTGAGAAAAACGGAGTAGACATCCTC
TCTGGAACTCGA
GTCAGGACACATTTTGCAAAACCGAACTGGAGAAAAGTTTTTGGCAACTTAGCATCACTTCATCCAAACGCTCGGATAGGAGTTTTCTTTTGTGGATCTAAAATTCTC
GCACGGGAACTTGATAGCCTAGCACGAGAATACTCGCACAACCAAGCCACCAAGTTCGACTTCCACAAGGAGAACTTTTGA

Retrieve as FASTA