Entry information : SbAPx07 (Sobic.006G084400.1[2.1] / Sb06g017080[1.4])
Entry ID 7416
Creation 0000-00-00 (Christophe Dunand)
Last sequence changes 2014-08-04 (Messaoudi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-10-15 (Christophe Dunand)
Peroxidase information: SbAPx07 (Sobic.006G084400.1[2.1] / Sb06g017080[1.4])
Name (synonym) SbAPx07 (Sobic.006G084400.1[2.1] / Sb06g017080[1.4])
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbAPx07
start..stop
S start..stop
ZmAPx07 579 0 34..344 32..339
SiAPx05 568 0 1..344 1..342
BdiAPx07 553 0 46..344 46..345
TaAPx02 549 0 47..344 47..348
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 46255670..46255843 174 N° 2 46255428..46255544 117 N° 3 46253583..46253703 121 N° 4 46253393..46253493 101
N° 5 46253222..46253309 88 N° 6 46252731..46252798 68 N° 7 46252554..46252640 87 N° 8 46252074..46252148 75
N° 9 46251917..46251994 78 N° 10 46251725..46251829 105 N° 11 46251527..46251547 21  
complement(join(46251527..46251547,46251725..46251829,46251917..46251994,4625207 4..46252148,46252554..46252640,46252731..46252798,46253222..46253309,46253393..4 6253493,46253583..46253703,46255428..46255544,46255670..46255843))


exon

Literature and cross-references SbAPx07 (Sobic.006G084400.1[2.1] / Sb06g017080[1.4])
DNA ref. Phytozome 11:   chromosome_6 (46255843..46251527)
EST ref. GenBank:   BE356878.1 [5' end]
Protein sequence: SbAPx07 (Sobic.006G084400.1[2.1] / Sb06g017080[1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   344
PWM (Da):   %s   37156.01  
PI (pH):   %s   9.21
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAERLAASAATLRASAAAAATPSARRAARASRAFFPPSPASSARARVGLRAAPSPLPQKARAVRCAAVAAASDVAQVKAAREDIRELLRTTHCHPILVRLGWHDAGTYDKNIEEWPQRGGANGSLRFDVELKHGANAGLINALKLIQPIKDKYPSITYADLFQLASATAIEAGGPKIPMKYGRVDVTGPEQCPPEGKLPDAGPSSPADHLREVFYRMGLDDEIVALSGAHTLGRSRPERSGWGKPETKYTKNGPGAPGGQSWTVEWLRFDNSYFKDIKEKRDQDLLVLPTDAALFEDPNFKVYAEKYAEDQDAFFSDYAEAHAKLSNLGAKFQPPQGFSLDD*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6, 10 introns) and 3 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGAGCGCCTCGCCGCATCCGCCGCCACCCTCCGCGCCTCGGCCGCCGCCGCCGCCACCCCGTCCGCGCGCCGCGCGGCGCGGGCCAGCCGCGCGTTCTTCCCGCCCTCGCCGGCG
TCGTCAGCTCGCGCGCGCGTTGGCCTCCGCGCCGCGCCGTCTCCGCTCCCGCAG
GTCCGTGTACCGCCTCCGTTACGTATCTGATAGGGCGGGTGCGCCTTGATCTTGAGATCGAAATGG
TGCAGCAGCAGCAGCATACAGGCTGTTGACTCGTGTTTACGTGTGTTGTGTGATCGCAGAAGGCGAGGGCAGTGAGGTGCGCGGCTGTGGCGGCGGCGTCTGACGTGGCTCAGGTGAAGG
CCGCGCGCGAGGACATCAGGGAGCTTCTCAGGACGACTCACTGCCACCCCATCCTG
GTGCGTACGGTGACCCTTGTTCTGCGCTTTAAATTACGTTATTCATAAACTTCGTCAATTATGA
ATTCATGATGGTGATTTAGGATTTGACTAACCCCTTTGCGAGCTTACCATCACACTGCTACATTTTTTTTAAAAAAGGAGAATTAACTCTGCTTTTCAGAAAGCAATAAGGTTTTACACA
CTGGGGATACCAGTTTACCAAAGCGAGTACAAAAAAGACAGCCAGCCACCTTGCTGAGCTACAAAGCTAAAGATAGAGTAGAAAACTTATTACAATCACACTGCTACAGTAGAAGATGCA
AGGCTTTAAATTATGATCTTACTATGCTAAGATCACTGTTGGTGAACATAGTGGTAGTGATCACTTTTAATAACTCTGTTAGTGATGTCCATTCTTATATGCCTCTGCAGCATATGGTTT
GTGAGCAGACCAAGCAGGGTGCCCGTTTTGTGCCTGTTACCATGTAATCCACTATTCACTGTTGAGCAGTGGTGGATCCAGAAAAAAAATGTTACTAGGGCCACTTCTACTAGAACATGG
GTCATTGCTCGGTTATAAATGATTTCCCTAGTTATGCTTAGAGATTTAATTAGCGCTTGCAACAAAGTGAATGGTTTCACTTGACACCAATGAGTGTATGCTGGAGCTGGCTCTTTTGTA
GCCCATATAGGCAAGCAAATAAGATTCGACATGAGTGGTTGGTTTGTTGTGAAATGGTATGAAATGTGTGAGAAAATTTACCATTACGAATTTCAAAAGACTTAGTGGTATGCTAGGGAA
GTTTGTTTGCTCATAAGATGGTATTAACTAATTCAAAGGGAATTGGCCAGTTCAAACTTAACGATGTAGTAATGACTAACGGTACTATGTTGATGAAGGGCATCATCCAATGCACGCTTC
AGGGTTATGTCAGAGTCTATTCATTTATTATGCTGCATTTTTAATCATTTTACATTTGCATGATCATATGACTTTTTGTCTTAAGTTTTAGAGGTTAAAGATACAACAGGACCGCCATTT
GTTGAGATAAGAGCATCTTCAGGTGTTTGGTATAATTTACTTGCTAAACTAATAGAGCTAGCAAATTAACAGAAGAATAGCAATCTTAAATTTTGTCCATCTCCAACATTCTCTTCCTAA
ACGATTTCACATTGGGAACCTGAACTATTTCTAACTAACAAAACCCTTTTTGTGTGTCTTACCACTTTCTCATCTGGAATCCTTTATTTTCTTAATTTACGCATGCGTCCAATTTACTCC
TATCTCCCGAGAAAAAAGCTGGGTGGGGAGCTGATATGGAATTCTTCTCGACTGCTAGTTGGAGAGAATATTTGGCAACTTTTTACTTTTAAGGACCTCTTTTACCAAACTGTTAGACAC
TTTTTTTCTTTTTTGCTAAAATATTAAAACAAGGAGTTGTTTTACAAAACTCCTGCTGAATGAATTTCTGTGTATTTCGATTCAGCTAACAAATGCAATGCTCCCTCCGTTCCAAATTAT
AAGTCACTTTGACTTTTTTGTACATCGATTTTGCCATGTATCTGGATATAACATATGTCTAGATACATAACAAATTTTATGTACCAGAAAAGTCAAAGCGACTTATAATTTGGAATAGAG
GGAGTATTTTCTAAGACATATATGTATGGAGTCAGGTTACCTTTGGTCTTCAGTTTCTGTATGCAAGATGACTTATTGTTATATGTTTGATTGGATGAAGGTACGTCTAGGATGGCATGA
TGCTGGTACATATGACAAGAATATTGAGGAGTGGCCACAACGAGGTGGAGCTAATGGAAGCTTAAGATTTGATGTTGAGTTGAAACATGGAGCCAATGCTG
GTACTGTTACTCAACTTCT
CTCAGTATCATTGTTTTATTCTTCTAAAGTGTGCTATTAGTAATTGCAATCTCTGATTGGAATTTATAAGGTCTGATAAATGCTCTAAAGCTTATCCAACCAATTAAGGACAAGTACCCG
AGTATCACTTATGCAGATCTATTTCAGTTGGCAAGTGCTACAGCAATTGAG
GTCTGACCTTTCCCTCATTGAAGTAGGCTATGTTATTTTTAATCATATGCTACCATGTTAAATACGACT
CAATTTCACTCCAGGAAGCTGGTGGCCCAAAGATTCCGATGAAATACGGACGAGTTGATGTTACAGGACCTGAGCAGTGCCCACCTGAAGGGAAGCTTCCTGGTTAGTAGAATTCCATGG
GCTTTGCAGTGTTCTTCATCCAGTACCAATGCCCTTTGTTAGTTTGCAGGGAAGAATTTAGATGCCAAAGATATACTTAGAGATTTCCCTTATCTGCTGGGAATATCAACAGGCTATGTT
CTGTTCCCAGGGAATCACGTCCTGGAACCGTTCCGGCCAGGAACACTTATATAATTTGTATAGGCCAGACTTCACCAGGAATCATTCCCAGCAGGAATGACCCGAACCAAACGAGCCCTA
AATGTATTTCACATTTTTTCAGAAATCACGGGAATACCTCCGCTGCCACATTGGTGTCAGAAAACTGTTGCTGTGTAGAGGGGAATAGATGCACCAGCATATAAGCCAATTCCACTAATC
TGATGCCTGCCAAATCTCAAGTTTTATTTATCTTGTGTTTCACAGATGCTGGCCCAAGTTCACCTGCTGACCACTTGAGGGAGGTATTCTACAGAATGGGCCTTGATGACAAGGTGTGCA
GATCGCAACACTTAACCCATTGCAGTATATGTGTCTAATTGACTTTGTTGAGCTGTTTGGAATTCTAATTATTGTGTTTGTAGGAAATTGTTGCCTTGTCTGGAGCACATACACTTGGAA
GGTCCAGGCCTGAACGGAGTGGCTGGGGGAAACCAGAAACAAAATATACT
GTATGTTCTTATCTTCTTTATGTGAACATCAGTTGTTCTTTTCTGCAGGAAGTCTGTTTTGAGCATGATC
TGTTCCATCCAATTTGTCTTGATCATGGATTGCATTGCATTTATAATTTTGCAATAAGAGGAACATTGCAATTTCTTAATGCTTTGGTACATTGCACCTGCACAGCTCCAAGGATTGTCT
TTAACCTTTCTGGGATGCTTTTGTGCAATATTTATGTACCGACTAAGTTCTGTGCATCATGTATTGTCTCTTCATCTTCTTAATTCGCTCGCTTGACTTATATATAAATCCTCTCCAGAC
CATTGAAACATTGGGACATGAATTATGTGAATATAAATTGGGCTTGTCTTGTTAATCGTGTGAGTTCATCTACCATGTCTTGTTACTCTTTACAGAAAAATGGTCCTGGTGCACCTGGTG
GGCAATCATGGACAGTTGAGTGGCTGAGATTTGATAACAGTTACTTCAAG
GTGCGTGCCTTTTGCCACATACTACATGCTGAAAAATCGATCCGAGTTCATCATCTCTTATCTGGTACCA
ATACTTCAGGATATCAAAGAGAAACGAGATCAGGATCTTCTGGTCCTACCTACAGATGCTGCTTTATTTGAGGACCCAAACTTCAAGGTGATCTCTGATGATCAACTGTATGATGTTGGT
ATCCTATGAAATTAATCGTTGAGCTTACTGTATGGGAATCCACAACACAACCAGGTCTATGCGGAGAAATATGCAGAGGACCAAGACGCATTCTTCAGTGACTACGCTGAGGCTCATGCT
AAACTGAGCAATTTGGGTGCGAAGTTCCAACCACCGCAG
GTTAGTGTTAACATTTTTGTCCTTAGTTTTCTTACAAGTACACTTTGCTCTTCATTAAAACGGCAATTTAATTGGTTCTGG
GAAGGAAACTGGCTGCTCAAAAATCATTGTTTTTTTTTCTTTTTTCTCAAACAAGTTGGGGCAACCTTATCGTCCTTTTTAATATTGATTCTGCAGGGATTCTCTTTGGATGATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGAGCGCCTCGCCGCATCCGCCGCCACCCTCCGCGCCTCGGCCGCCGCCGCCGCCACCCCGTCCGCGCGCCGCGCGGCGCGGGCCAGCCGCGCGTTCTTCCCGCCCTCGCCGGCG
TCGTCAGCTCGCGCGCGCGTTGGCCTCCGCGCCGCGCCGTCTCCGCTCCCGCAG
AAGGCGAGGGCAGTGAGGTGCGCGGCTGTGGCGGCGGCGTCTGACGTGGCTCAGGTGAAGGCCGCG
CGCGAGGACATCAGGGAGCTTCTCAGGACGACTCACTGCCACCCCATCCTG
GTACGTCTAGGATGGCATGATGCTGGTACATATGACAAGAATATTGAGGAGTGGCCACAACGAGGTGGA
GCTAATGGAAGCTTAAGATTTGATGTTGAGTTGAAACATGGAGCCAATGCTG
GTCTGATAAATGCTCTAAAGCTTATCCAACCAATTAAGGACAAGTACCCGAGTATCACTTATGCAGAT
CTATTTCAGTTGGCAAGTGCTACAGCAATTGAG
GAAGCTGGTGGCCCAAAGATTCCGATGAAATACGGACGAGTTGATGTTACAGGACCTGAGCAGTGCCCACCTGAAGGGAAGCTTCCT
G
ATGCTGGCCCAAGTTCACCTGCTGACCACTTGAGGGAGGTATTCTACAGAATGGGCCTTGATGACAAGGAAATTGTTGCCTTGTCTGGAGCACATACACTTGGAAGGTCCAGGCCTGAA
CGGAGTGGCTGGGGGAAACCAGAAACAAAATATACT
AAAAATGGTCCTGGTGCACCTGGTGGGCAATCATGGACAGTTGAGTGGCTGAGATTTGATAACAGTTACTTCAAGGATATCAAA
GAGAAACGAGATCAGGATCTTCTGGTCCTACCTACAGATGCTGCTTTATTTGAGGACCCAAACTTCAAG
GTCTATGCGGAGAAATATGCAGAGGACCAAGACGCATTCTTCAGTGACTAC
GCTGAGGCTCATGCTAAACTGAGCAATTTGGGTGCGAAGTTCCAACCACCGCAG
GGATTCTCTTTGGATGATTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GCCGAGCGCC TCGCCGCATC CGCCGCCACC CTCCGCGCCT CGGCCGCCGC CGCCGCCACC CCGTCCGCGC GCCGCGCGGC GCGGGCCAGC CGCGCGTTCT TCCCGCCCTC GCCGGCGTCG  TCGGCTCGCG CGCGCGTTGG CCTCCGCGCC GCGCCGTCTC CGCTCCCGCA GAAGGCGAGG GCAGTGAGGT GCGCGGCTGT GGCGGCGGCG TCTGACGTGG CTCAGGTGAA GGCCGCGCGC  GAGGACATCA GGGAGCTTCT CAGGACGACT CACTGCCACC CCATCCTGGT ACGTCTAGGA TGGCATGATG CTGGTACATA TGACAAGAAT ATTGAGGAGT GGCCACAACG AGGTGGAGCT  AATGGAAGCT TAAGATTTGA TGTTGAGTTG AAACATGGAG CCAATGCTGG TCTGATAAAT GCTCTAAAGC TTATCCAACC AATTAAGGAC AAGTACCCGA GTATCACTTA TGCAGATCTA  TTTCAGTTGG CAAGTGCTAC AGCAATTGAG GACGGAGTGG CTGGGGGAAA CCAGAAACAA AATATACTAA AAATGGTCCT GGTGCACCTG GTGGGCAATC ATGGACAGTT GAGTGGCTGA  GATTTGATAA CAGTTACTTC AAGGATATCA AAGAGAAACG AGATCAGGAT CTTCTGGTCC TACCTACAGA TGCTGCTTTA TTTGAGGACC CAAAGTTCAA GGTCTATGCG GAGAAATATG  CAGAGGACCA AGACGCATTC TTCAGTGACT ACGCTGAAGC GCATGCTAAA CTGAGCAATT TGGGTGCGAA GTTCCAACCA CCGCAGGGAT TCTCTTTGGA TGATTAGTGC AGCAACAGAG  CTCCAGTCCG TGAAACAGGA AAATGCTGTC CTTGAACAGG ATCAAGATTC AAGAGGAAAC ATACAATTCA TTGCTCTTCT CATATCATCA TCGTACAAGA TGGACTGGTC CCCGGCTTTC 
CATGATGCTA TATATGAGTC TTCCAATTTA GCAAGATTTT GGAACCATCG AGCTTGCAAA TAAAAGAACT GACACAGTGA CACTACATAA ATAATATCAG AGCCATTGTG 

Retrieve as FASTA