Entry information : SbAPx06 (Sobic.008G057900.1 [2.1] / Sb08g004880 [1.4])
Entry ID 7417
Creation 0000-00-00 (Christophe Dunand)
Last sequence changes 2010-06-03 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbAPx06 (Sobic.008G057900.1 [2.1] / Sb08g004880 [1.4])
Name (synonym) SbAPx06 (Sobic.008G057900.1 [2.1] / Sb08g004880 [1.4])
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbAPx06
start..stop
S start..stop
SiAPx06 598 0 1..313 1..311
HvAPx05 586 0 1..313 1..312
TaAPx03 585 0 1..313 1..313
ZmAPx06 585 0 1..313 1..313
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 6062793..6062876 84 N° 2 6062968..6063084 117 N° 3 6063519..6063639 121 N° 4 6063713..6063813 101
N° 5 6063919..6064006 88 N° 6 6065163..6065230 68 N° 7 6065316..6065402 87 N° 8 6065888..6065962 75
N° 9 6066038..6066115 78 N° 10 6066204..6066308 105 N° 11 6066395..6066412 18  
join(6062793..6062876,6062968..6063084,6063519..6063639,6063713..6063813,6063919 ..6064006,6065163..6065230,6065316..6065402,6065888..6065962,6066038..6066115,60 66204..6066308,6066395..6066412)


exon

Literature and cross-references SbAPx06 (Sobic.008G057900.1 [2.1] / Sb08g004880 [1.4])
DNA ref. Phytozome 11:   chromosome_8 (6062793..6066412)
Protein sequence: SbAPx06 (Sobic.008G057900.1 [2.1] / Sb08g004880 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   313
PWM (Da):   %s   33935.42  
PI (pH):   %s   7.71
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVHHLLRRGVSSGSPIHPLRGLFLASKELGRHPLSSAAAGDAAAELRSAREDVRQLLKATSCHPILVRLGWHDAGTYDKNIPEWPKCGGANGSLRFEVELKHGANAGLVNALKLIQSIKDKFSGVTYADLFQLASATAIEAGGPKIPMIYGRVDVTAPEQCPPEGRLPAAGPPSPAEHLREVFYRMGLNDEIVALSGAHTLGRARPERSGWGKPETKYTKDGPGAPGGQSWTSQWLKFDNSYFKAIKERRDEDLLVLPTDAVLFEDSSFKIYAEKYATDQDAFFEDYAEAHAKLSNLGAKFDPPKGISLE*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 8, 10 introns) and 9 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGTCCACCACCTTCTCCGCCGCGGGGTCTCCAGCGGCTCACCGATCCACCCTCTCCGCGGCCTCTTCCTCGCCTCCAAGGTACCTGCGGCTCCTCCCCTCGCCCTTACCCACTGC
CCTCGCCGTCACACCGGTCCTTGATTTCGTGCGTGCTTCTTTCCCGGCGGCGCAGGAGCTTGGGCGGCACCCGTTGAGCTCGGCGGCGGCGGGAGACGCAGCGGCCGAGCTGAGGAGCGC
GCGGGAGGACGTCAGGCAGCTGCTCAAGGCAACCTCCTGCCATCCCATCCTG
GTACGGTAGTTCTTTCTCCTCGTGCCGAGGCTCCCTGCGGTTGGAGCAGACAAGTGATTGTACTGTGG
GATCTTGTTTATTCATCTAGCCACCCAGAGATTCTGCATCTCTACAAAGTCTCTCTCATGTTTTCGTTCAATTGATGAAATAATAATACTCTGCAACCTTTTGTTTTGGGTAAGGAAGGA
ACTCGGTCGATTTAGTTGGCCATATTTTTACTCAGCTGACCACACATCAGTTTATGCAACAGAGTTAGCTTTGGGAGATGTATTAGTGCCCCAAATGCACTGTTCTTTCTGTTTATGCTA
GATTAATTTTGGTATTTTTGCTTGTGTGCACATTACTGTTTTCCTCTTCGCGAATCGCAATCCAGCATTAGCTGCTTCAGCCTCCGGGTTGCTTAGATACGACTTACGAGTTATATTTTT
GTTCAGGTTCGATTAGGTTGGCATGATGCTGGTACCTATGACAAGAACATTCCTGAGTGGCCCAAGTGCGGTGGAGCTAATGGTAGCTTGAGATTTGAAGTCGAGTTAAAACATGGGGCC
AATGCTG
GTAAAGCTTCTTCTCAATCGATTAACTGTAACTTCATGATGAGGGGATACTCTTACATTTAGTTTCATAACAGGTCTTGTGAATGCTCTGAAGCTGATCCAATCGATCAAGGA
CAAGTTTTCAGGTGTTACGTATGCAGATCTGTTTCAGCTTGCCAGCGCCACAGCCATTGAG
GTCCCTTAAAATTGCTCCAGCTTGCCAATGATTAGGTGATATTTATTCATAAATTGTTT
CTTGTTAATGACAACTGACTGGTTGTTCTGGTTTCTTTCATTTCAGGAAGCAGGTGGCCCCAAAATTCCGATGATCTATGGAAGGGTTGACGTTACTGCCCCTGAACAATGCCCACCAGA
GGGGAGGCTTCCTG
GTCAGTAATAATGAATTTTTGACCGATCTTAACTCATATACCATAGTGCCAATTTATGTTGAGTCTGACTCAGAATCCAGAACCTAGAACATAGGGTTGTTCCTTG
AGTTTCATTTGATTGATGTTAATCCAAGCATACTCTTACAATCATTGCTTAGTGATTGAAACACCGAATCGGTATCTGATTCATTAACCTTTGTATGGTTGTGCTCAGAGTTCCACCACA
TAGCAAACTTTCAGCTAACTCCCCGATTAAAACATCGATACCTATCTCTTATCAAATCATTATCATATTTAAACCCATAGATGACTTGTATTTGCTTGCTTAGTTGTTCATGAAAGTTTG
GCATGTTAGCACACTGGCAGCTTTCAACAGATTAATATTACCAAAGTTTATGATCCATGTCACAGAAAATATACTTTGTCCTAGTCCTGGACATCATCCACTTTAAGCTGAGACACATCC
TATCAGATTTATGGTACCTAATGTTTATTTGTCTTCAAGGTGCAAATTTGGCACACCAAAAACTAAAATACAAACAAAATGCTGATGCAATATTGGAAGTAGAGGATGTAAATACAGCCC
TGGCTAACTTTAATGGTATCCCTTTTCATTCCACCAGTGTTTGTTGGGTTATCTGTAGTGCCTCCAAATTCAGCTTTTGAGATGCTTAGGACAGATTAATCTATATTCTTTTGGAATTTA
ATTAGTAAGATATGAAGGTAGAAACAAGCTAAAGTCATAGAACAGTGTTATGTGATCTGTAAAGCATAAGTCTTTTTAAAGAATTACCTTTGTGGGATTTACAGTCTGGTCAAATCAAAT
GGCTGAACATGCAGAGTGCACAGGGTAAATTGTTTCAAGTTCCCACATCCTACAATGTAACAAAATATTGAGAAGCTGCGCTACCTAGAATAGAATCATGTTCATACAGTTGTCTTATGG
TCATAGAATTCAAAATGACACTGCACATTATCTTCCTAAGCATTGCAATTTTCTTGTTTCAAACACCCCTATCCAGTGGTTCCTGATTGATCTCTTCATGCCATATAATTATTTAAGTTG
ACAGTTCAACACTATACTGCCAATGCTTTGTTTCTGTACAGAAGATTTTATTCCAAGGTTACTCATATTTCTATTTTCTCACCCATGCAGCTGCTGGCCCACCTTCACCTGCGGAACATT
TGCGTGAAGTATTCTACAGAATGGGCCTGAATGACAAG
GTGTGAAGTGTGAACTGAATGCTGTGTTTAAATTAGACTCGGCATAATTCTATATTTGCTAGTTACAACTATTTCCGTTCTG
TAGGAAATTGTTGCACTGTCAGGAGCTCATACACTTGGACGGGCAAGACCAGAGCGTAGTGGCTGGGGTAAACCAGAAACAAAGTACACTGTATGTAACCTACAGATTTAATCATGTGCT
GTCCTTTTTTTCAGTTATTGCATTTGCATGCCTGTCCCTGTCCTTCATAATTTACTTATTATATTAGGGAGTAAAATGTGAGTGTAACCAGTATTTTTTATTCGTGCTAGACTGCTAGTT
AATTTCTTGTTTGGCTTTGTCCTACTGATTGGTCCTTGCTTATACATTTGCTGCATGGACACCATATTTGATTACTTGTCTGTGCTGTTATCTGATAAGACATTATTGTCTACTCTGCCC
GCTTTTCACTATATTGTGGTGTGTCTGCTAGCTTTCTCCTCTATGGATCTTATCTATATTCTCTCCACCATTATTCTTGTAAAGATGCTCTTTGTGTGATTAGTACACTAATAGCACCTT
CACATTTATACAGTCTTGTTTGCTGAATGGTGATGGAGTGGTGTTACCTCACTCATTTGTTAATTGTTCTTTTGTTTGATACTTTGATATGCCAGAAAGATGGACCTGGTGCACCTGGGG
GGCAATCTTGGACATCTCAATGGCTCAAGTTTGACAACAGCTATTTCAAG
GTATTGTCCATAAGTTTGCCATAGGATACCTTTCAATCATGTAGCTTTAACAAAAATGTGGGCATAACAA
TTCAGGCTATCAAAGAAAGGCGAGATGAGGACCTCCTAGTTCTGCCTACTGACGCTGTGCTGTTTGAGGATTCCTCATTCAAGGTTAGTGAAGGTCCTCATGTTGCAAAAAACTGCACAT
ATCTAGCTTTTCTCTTGGACCAAGTCTCATGATGACTTTTCATACTTGAAGATCTATGCTGAGAAATACGCCACGGATCAGGATGCATTTTTCGAGGACTATGCTGAAGCTCATGCCAAA
TTAAGCAATCTTGGGGCAAAATTTGACCCGCCAAAG
GTAAAAGGATTCATGACACTTTCCAGTCTTGAGAGGTGGTCAGGTACTCAGGTCATGTAACATGCTTTTCATTGAAATGTTTGC
AGGGCATCTCACTTGAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGTCCACCACCTTCTCCGCCGCGGGGTCTCCAGCGGCTCACCGATCCACCCTCTCCGCGGCCTCTTCCTCGCCTCCAAGGAGCTTGGGCGGCACCCGTTGAGCTCGGCGGCGGCG
GGAGACGCAGCGGCCGAGCTGAGGAGCGCGCGGGAGGACGTCAGGCAGCTGCTCAAGGCAACCTCCTGCCATCCCATCCTG
GTTCGATTAGGTTGGCATGATGCTGGTACCTATGACAAG
AACATTCCTGAGTGGCCCAAGTGCGGTGGAGCTAATGGTAGCTTGAGATTTGAAGTCGAGTTAAAACATGGGGCCAATGCTG
GTCTTGTGAATGCTCTGAAGCTGATCCAATCGATCAAG
GACAAGTTTTCAGGTGTTACGTATGCAGATCTGTTTCAGCTTGCCAGCGCCACAGCCATTGAG
GAAGCAGGTGGCCCCAAAATTCCGATGATCTATGGAAGGGTTGACGTTACTGCCCCT
GAACAATGCCCACCAGAGGGGAGGCTTCCTG
CTGCTGGCCCACCTTCACCTGCGGAACATTTGCGTGAAGTATTCTACAGAATGGGCCTGAATGACAAGGAAATTGTTGCACTGTCAGGA
GCTCATACACTTGGACGGGCAAGACCAGAGCGTAGTGGCTGGGGTAAACCAGAAACAAAGTACACT
AAAGATGGACCTGGTGCACCTGGGGGGCAATCTTGGACATCTCAATGGCTCAAG
TTTGACAACAGCTATTTCAAG
GCTATCAAAGAAAGGCGAGATGAGGACCTCCTAGTTCTGCCTACTGACGCTGTGCTGTTTGAGGATTCCTCATTCAAGATCTATGCTGAGAAATACGCC
ACGGATCAGGATGCATTTTTCGAGGACTATGCTGAAGCTCATGCCAAATTAAGCAATCTTGGGGCAAAATTTGACCCGCCAAAG
GGCATCTCACTTGAGTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CCTACTGGAT TGCTATTGGT CCATGGTTCC ATTCCCTTCT CCAGCCTCCA CTGACGCGGA CCATTCTTCC TCTAAACCCC TCCTCTCCCC CGCCGCCGGT GCACCGACAT GGCCGTCCAC  CACCTTCTCC GCCGCGGGGT CTCCAGCGGC TCACCGATCC ACCCTCTCCG CGGCCTCTTC CTCGCCTCCA AGGAGCTTGG GCGGCACCCG TTGAGCTCGG CGGCGGCGGG AGACGCAGCG  GCCGAGCTGA GGAGCGCGCG GGAGGACGTC AGGCAGCTGC TCAAGGCAAC CTCCTGCCAT CCCATCCTGG TTCGATTAGG TTGGCATGAT GCTGGTACCT ATGACAAGAA CATTCCTGAG  TGGCCCAAGT GCGGTGGAGC TAATGGTAGC TTGAGATTTG AAGTCGAGTT AAAACATGGG GCCAATGCTG GTCTTGTGAA TGCTCTGAAG CTGATCCAAT CGATCAAGGA CAAGTTTTCA  GGTGTTACGT ATGCAGATCT GTTTCAGCTT GCCAGCGCCA CAGCCATTGA GGAAGCAGGT GGCCCCAAAA TTCCGATGAT CTATGGAAGG GTTGACGTTA CTGCCCCTGA ACAATGCCCA  CCAGAGGGGA GGCTTCCTGC TGCTGGCCCA CCTTCACCTG CGGAACATTT GCGTGAAGTA TTCTACAGAA TGGGCCTGAA TGACAAGGAA ATTGTTGCAC TGTCAGGAGC TCATACACTT  GGACGGGCAA GACCAGAGCG TAGTGGCTGG GGTAAACCAG AAACAAAGTA CACTAAAGAT GGACCTGGTG CACCTGGGGG GCAATCTTGG ACATCTCAAT GGCTCAAGTT TGACAACAGC  TATTTCAAGG CTATCAAAGA AAGGCGAGAT GAGGACCTCC TAGTTCTGCC TACTGACGCT GTGCTGTTTG AGGATTCCTC ATTCAAGATC TATGCTGAGA AATACGCCCC GGATCAGGAT  GCATTTTTCG AGGACTATGC TGAAGCTCAT GCCAAATTAA GCAATCTTGG GGCAAAATTT GACCCGCCAA AGGGCATCTC ACTTGAGTAG ATGTGGATGA AGGCGACTCG ACAGGGTCAT  GTTCCTTTGC ACGACCATTT TCGAAGGTTT TGCATGGAAA ACTTGTTCGA GTTCATTGAC GGCCCCAGAA GAAGGATTCA CTGATTAAAG GAAGATTTTT GTGCTGAGCA TGCTCTATTT  GAGTAGTATG CTACACTAGA ATAAAGAGGC ATCCGTCATT TCAGGATAAA TATTTGTCAC ACTAACCGAC GTTTACCTTG GTTGCATGGT ACTGCATTCA GCTTACCAAA TGAATGTTCC  CACCGAATTG AACCAAATTT TGTTCTTCCA TGTGTCCTGT TTGTCATTTA TGCTAGATTA CATGCGCAAA TCTTATGACA CTCAAATTTG AGTTTTATTG AGATGACATA TACTCTCTCC 
GTCCT 

Retrieve as FASTA