Entry information : PpaPrxII06 (PpaPrxIIF)
Entry ID 7424
Creation 0000-00-00 (Christophe Dunand)
Last sequence changes 2010-06-03 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: PpaPrxII06 (PpaPrxIIF)
Name (synonym) PpaPrxII06 (PpaPrxIIF)
Class Atypical 2-Cysteine peroxiredoxin (type II)    [Orthogroup: PrxII001]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaPrxII06
start..stop
S start..stop
MpPrxII04 262 1e-90 10..198 14..195
LuPrxII119 265 1e-90 1..195 55..252
AlyPrxII06 259 2e-89 1..195 1..198
AtPrxII06 257 1e-88 1..195 1..198
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 679770..679976 207 N° 2 679300..679329 30 N° 3 678943..679101 159 N° 4 678686..678780 95
N° 5 678452..678557 106  
complement(join(678452..678557,678686..678780,678943..679101,679300..679329,6797 70..679976))


exon

Literature and cross-references PpaPrxII06 (PpaPrxIIF)
DNA ref. Phytozome 11:   scaffold_31 (679976..678452)
Cluster/Prediction ref. UniGene:   Ppa.14871
Protein sequence: PpaPrxII06 (PpaPrxIIF)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   198
PWM (Da):   %s   21576.04  
PI (pH):   %s   9.37
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAFMVRQRGQGLWKNAMAMGQQYMQLRQMGSAAKKIDLESDVALQEARTWDEGVSTKFSTTPVSEIFKGKKVAIFGLPGAFTGVCSQKHVPSFLNNSDKLKSKGIDSIVCVSVNDPYTMNAWAEKLGAKDKIKFYGDFDGKFHKSLGLDLDLSGALLGPRSQRYAAVVEDGKIKQLNVEEVPSDFKVSDAETLLKGL

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns) and 61 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCTTTCATGGTGAGGCAGCGAGGGCAGGGGCTGTGGAAGAATGCGATGGCCATGGGCCAGCAGTACATGCAGCTTCGGCAGATGGGCTCGGCCGCTAAGAAGATCGATCTAGAA
TCTGATGTCGCCTTGCAGGAGGCTCGCACCTGGGACGAGGGCGTCTCCACCAAATTCTCCACTACCCCAGTTTCCGAGATCTTCAAG
GTTCGTGTTAATGGCTCCCTTTTCTGTGAGTAG
TAGCATGTGTTGGTATTGTGGGTTGTCGTTGCCTTGTGCTTTCCCCTGGTATTAGCCAGCGGTGGTTTCAACTTGATTACTTAAAAATAGTAGAACTAGCAATTTAGGTTATTTCGGATA
ACTGGTGGCGTTTTCTGTTCAACTAGATTTAGAACTGTATCGTCTCTTTCATGTTTTTTCCTTTTTATAAATCTTGGCAATGGCGTCAAGAGGATTGTTCCTGCGTTCCTTGCATTGACC
GCAGTGTTAGTCAATTGTCTAGAATATTCGTCCCACAGTACTTCGAGAAGTAAGCCCGTTGTGGGAGTTGGTGACCATTGTGTGTTGTGAACAAATGTGAAAAGATCGTGACAGTTCTGA
TCAGAATTCTAACATTCATTTCCTTTATGTATTTAAATGTTTTGTAGGGGAAGAAGGTTGCTATCTTTGGTCTTCCTGTAAGTGCTCGCTCACCTTGACATCTTAACTTTCACCTTGTTA
ATTTGAAGATGGTTTTGTTGTTACACATGCCTGTCCTTCAATTGTCAATTTTTGGGTTAGGAAGCTTGACCTGGATGAGCACAATTTGTTTGGTCCTTGAAGGTGTGAAGGGCACGAGAT
TACCGATTTGAAGTTGCTCTTATCTTTCTCTGCAGGGTGCATTCACAGGGGTTTGTTCTCAGAAACATGTGCCAAGTTTCCTGAACAACTCAGACAAGTTGAAATCGAAGGGAATAGACT
CCATTGTGTGTGTCTCTGTGAACGATCCCTACACCATGAATGCCTGGGCAGAGAAGCTGGGTGCCAAGGACAAG
GTTGGTCGTGACCATTTCTCACTCAGTAAACATTCACGAATCCTCT
TCTAGTAACGATTTTTTTTTTTCTTTTCCCCTCCGTTCCTGCACACCTTCAAAAGCAATGCAGATCGATTTCATTAGAAGTATCAATTTGCTTAGCTGATTCATGGATGTCTCCAGATCA
AATTTTATGGTGATTTCGACGGCAAGTTCCACAAATCTCTTGGCCTCGACCTCGATCTGTCAGGCGCTCTTCTCGGACCTCGCTCTCAAAG
GTAAGCTTTCATGTTAGTTACCACTGGAC
TTGATGGAATCTTAGTCTTGCACCATCTTTGTGCAATCGTTTGTCTCATTACAAACTCTGTGCACGTAAGAAGTGAAATGGCATACATGTATATTGCAGGTACGCGGCAGTCGTTGAGGA
CGGAAAAATCAAACAATTGAACGTTGAGGAAGTCCCGTCAGACTTCAAAGTATCCGACGCCGAAACACTGTTGAAAGGACTGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCTTTCATGGTGAGGCAGCGAGGGCAGGGGCTGTGGAAGAATGCGATGGCCATGGGCCAGCAGTACATGCAGCTTCGGCAGATGGGCTCGGCCGCTAAGAAGATCGATCTAGAA
TCTGATGTCGCCTTGCAGGAGGCTCGCACCTGGGACGAGGGCGTCTCCACCAAATTCTCCACTACCCCAGTTTCCGAGATCTTCAAG
GGGAAGAAGGTTGCTATCTTTGGTCTTCCTGGT
GCATTCACAGGGGTTTGTTCTCAGAAACATGTGCCAAGTTTCCTGAACAACTCAGACAAGTTGAAATCGAAGGGAATAGACTCCATTGTGTGTGTCTCTGTGAACGATCCCTACACCATG
AATGCCTGGGCAGAGAAGCTGGGTGCCAAGGACAAG
ATCAAATTTTATGGTGATTTCGACGGCAAGTTCCACAAATCTCTTGGCCTCGACCTCGATCTGTCAGGCGCTCTTCTCGGACCT
CGCTCTCAAAG
GTACGCGGCAGTCGTTGAGGACGGAAAAATCAAACAATTGAACGTTGAGGAAGTCCCGTCAGACTTCAAAGTATCCGACGCCGAAACACTGTTGAAAGGACTGTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AATTCGTGAA CATGCACATG TCCATCTGGA CGTTCTATCT ATCTATAGTA CTATGCGCAA ATTCGTGGAT GTGACAAAAG CAATGGATTC GGGGATCACC AGTGCGCATT TCGTCCCTTT  GCCAGCAAGC AGAGCTCTTG TGCAACCCTT ATTTTTGTGC GTCCAATCCT CAAGGCCGAT TAATTTCTCG TCTCTGCTAC TCTAGTGCGA TAACCCATCT GTTGTTTTAG CCATTTGAAG  CTTTAGGGTC GCCATCTGGG CTTCGCAGCG ATGGCAGCTT TCATGGTGAG GCAGCGAGGG CAGGGGCTGT GGAAGAATGC GATGGCCATG GGCCAGCAGT ACATGCAGCT TCGGCAGATG  GGCTCGGCCG CTAAGAAGAT CGATCTAGAA TCTGATGTCG CCTTGCAGGA GGCTCGCACC TGGGACGAGG GCGTCTCCAC CAAATTCTCC ACTACCCCAG TTTCCGAGAT CTTCAAGGGG  AAGAAGGTTG CTATCTTTGG TCTTCCTGGT GCATTCACAG GGGTTTGTTC TCAGAAACAT GTGCCAAGTT TCCTGAACAA CTCAGACAAG TTGAAATCGA AGGGAATAGA CTCCATTGTG  TGTGTCTCTG TGAACGATCC CTACACCATG AATGCCTGGG CAGAGAAGCT GGGTGCCAAG GACAAGATCA AATTTTATGG TGATTTCGAC GGCAAGTTCC ACAAATCTCT TGGCCTCGAC  CTCGATCTGT CAGGCGCTCT TCTCGGACCT CGCTCTCAAA GGTACGCGGC AGTCGTTGAG GACGGAAAAA TCAAACAATT GAACGTTGAG GAAGTCCCGT CAGACTTCAA AGTATCCGAC  GCCGAAACAC TGTTGAAAGG ACTGTAGAAC AATGCAGTTA ATGTTGGTGG AGGTTCGTAG AGTTTATGTA GCAGGAGAAT CACGTCCTTT GCACACGTGA CTTGGAAACT TATAACTTAT  TGTGACAATT GTAATCACCG CCAACGTTAT GCCAACCCCC GTCCGCCGGG TGCTACCTAC TGAACATGCC AATCTTAGTA GACAGAGGAC ATGGACAAAT ACGGTTCTCA CAAATTCTAT 
TCTCG 

Retrieve as FASTA