Entry information : PpaPrxII0503 (PpaPrxIIE03)
Entry ID 7428
Creation 0000-00-00 (Christophe Dunand)
Last sequence changes 2010-06-03 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: PpaPrxII0503 (PpaPrxIIE03)
Name (synonym) PpaPrxII0503 (PpaPrxIIE03)
Class Atypical 2-Cysteine peroxiredoxin (type II)     [Orthogroup: PrxII001]*
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaPrxII0503
start..stop
S start..stop
PabPrxII178 254 8e-84 130..313 63..239
PpaPrxII0502 253 3e-83 152..315 85..248
PpaPrxII0501 250 5e-82 152..315 82..245
AcvPrxII05 246 1e-80 121..313 38..229
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1458973..1459968 996 N° 2 1457157..1457351 195  
complement(join(1457157..1457351,1458973..1459968))


exon

Literature and cross-references PpaPrxII0503 (PpaPrxIIE03)
DNA ref. Phytozome 11:   scaffold_1 (1459968..1457157)
EST ref. GenBank:   DC914986.1 [Fragment]   DC928735.1 [Fragment]
Protein sequence: PpaPrxII0503 (PpaPrxIIE03)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   396 (378)
PWM (Da):   %s   42387.11 (40428.1)  
PI (pH):   %s   10.45 (10.45) Peptide Signal:   %s   cut: 19 range:19-396
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTIHLLSAVMHLQSVLQGSSKCGYTQQSSRHGFFSTKATTTNPLSVSNARASAAVQLKLVVNRAPPLLAFRIIWGLNALTFAFHINQATRSNTMAATAIAIRTFTNAAALSRGGTNLWSTYSRSLATLVPSHIRGVAAVRTLPTFGSRAATTIAEGSKLPDAELSYFDKEGNVNIVKVSDLMRAKKVVLFAVPGAFTPTCSTQHLPGFVAKADKLRKAGADLLACVSVNDAFVMRAWGENQNVGESVLLLSDGLGKFTHAMGASVDLSDKPVGLGVRSRRYAMLVDDGVVKTLHMEEGGAFTSSGADDILKALLKRKTSAATAPECANQNTTDLRLILDAMLLQPQLKETAHEFVFKFGTTTITIIVTIPTQHTNTCDRLKGSTQWSRTCSRCRLK*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron) and 2 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTATTCATCTTCTATCGGCAGTTATGCACCTGCAGTCAGTTTTGCAAGGTAGTTCAAAATGTGGATATACTCAACAATCATCCCGACATGGATTTTTCTCAACCAAAGCAACCACA
ACCAACCCCCTCTCTGTGTCGAACGCACGTGCAAGTGCTGCAGTGCAACTGAAACTCGTTGTAAATCGAGCACCTCCGCTTCTGGCATTCAGGATCATTTGGGGGCTTAATGCGCTAACA
TTTGCATTCCACATCAACCAGGCCACTCGCAGCAACACCATGGCTGCTACAGCAATAGCAATACGAACCTTCACAAACGCCGCTGCTCTTAGCAGGGGAGGGACAAACCTCTGGAGCACT
TACTCCCGCTCTCTGGCAACGCTCGTTCCAAGCCACATTCGCGGCGTCGCTGCAGTGAGGACACTGCCCACATTCGGATCCCGAGCGGCGACCACCATCGCGGAGGGCAGCAAGCTCCCC
GACGCCGAACTCTCGTATTTCGACAAGGAGGGTAACGTAAACATCGTCAAAGTCTCGGACCTCATGCGTGCCAAGAAGGTAGTCCTCTTCGCAGTCCCCGGCGCCTTCACCCCGACGTGC
TCCACGCAGCACCTTCCCGGATTCGTGGCCAAGGCGGACAAACTGCGGAAAGCAGGCGCGGATTTGCTGGCGTGCGTGAGCGTGAACGACGCCTTCGTGATGCGAGCGTGGGGGGAGAAT
CAGAACGTGGGCGAGAGTGTGTTGTTGCTGTCGGACGGGCTGGGGAAGTTCACGCACGCGATGGGCGCGAGCGTGGACCTGAGCGACAAACCCGTGGGGTTGGGGGTGCGGTCGCGGCGG
TATGCGATGCTGGTGGACGACGGCGTGGTGAAGACGCTGCATATGGAGGAGGGCGGCGCCTTCACCAGCAGCGGCGCCGACGACATCCTCAAGGCCTTGCTCAAGCGCAAGACCAGCGCC
GCCACCGCGCCCGAGTGCGCCAACCAGAACACCACG
GTGCGTCACTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTAGAATCAATGAAAATCACTGTTTCATGGTCTGGAGTTTGAAGTTCATTCAAGATTGTTTATTTAAATATACATATGATGCATGCATCAGATGTTGTTTGAGAGTTGTTTGCAGAT
CCAATCATAGTAGGTATTCTAACATTTGATTTGAGTGATTGTGAACTGTTTCGATTTTGCAGTGATGATGCTGATAATGATTTTATGAGACACGTCCAAGCAAAAGTTTGTAAAACATTG
AATTGAAATGGTTTGCAATTTGAAACCATCATTGACTGGTACGATAAGAACATGTGAATTAGAAAAATGAGAACTGAATTTCTCTTCTGTGAGACAAATCATCACAAGTTAAATGCCCAA
GTAAGCACATTCATTGAAATTCTAATGAAAGAGTTCATTCTCATCTCAAATATCAATTTTCATTGTTTGTGATGTTTGAGCTGAATCAAAGCTCCCACAGTTCTGTTTCTCACACAGAGC
AAAGCAAAAATGATGGTAATTGAAAATTTTACATTATACTGTACTTCTCTCATTTCAGATACACCTAACTTGTTCTGCTAAAGTACATGAACTTGATTTGGCATTAAATTAGTTCATAAT
TTGATACAACTTGATATCAACTATACACACATATTTAACAAAGTAAATGGGTTCATAAGTTTCATTTACTCTTCACATGATAGTTATATAGCAAACTTAAATTCAATTAGTATTGTTGAA
TTTTCACTTTATTTTTAAAAATCATATCTCATTCATTTTGTATAATAATTAGTTGGTAAATTGATCAGTTAGTTTTACATTTAAGATTTATGTAGCAAACAACCAATTTTACAAGTTTAA
AAAATTTAACATTTTATTGAATGTGGTTTCTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTCATTCAGATCAATGTTCNNNNNNNNNNNNNNNNNNNNNNNC
TAATCAAACCTCCTCATGTATTGTTATATGTTTTTTGCTCTACAAATACAGTATTCATTTCATAGTTTCTTATATTGGACATTTCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNGAAAATTCTATGAATTGATCCTCATGGTAATTAAAAATCAATAATCGAAACACAATAATAAAATTTAAAACTTTATATAAGATAGGATTATGAACNNNNNNNNNNNNNNNNN
NNNNNGATATATCTACTTGTCTTATAAAAAGAACACAACATTGGATAAAATAAAATACAAATGAACCCAGTTGCATATGATTATATTTGAAAAATATCCTTTTATTTTTGATTTTTAATA
ATACAGTCTTCTAATAGTCTTTTAAAATATAGGTCGTATTAAAGAGCTAAATAGTAAGTTATGAACTTATGGGAAAAGGTTAAACCGACATTAACCACCATGATTTATTACTTAATTGAT
ACTTACACTCTTATATTTTCCTCCAAGAGCCATGCAATCAAAACCTCAAAATAAACTTTGTTAGAATCAATGGGTGTTTTGCAATTTTCATTAGCAGGATTTGAGGCTCATTCTTGATGC
AATGCTCCTACAACCTCAGCTCAAAGAAACTGCTCATGAGTTTGTCTTCAAGTTTGGCACCACAACCATCACAATCATTGTAACCATACCCACACAACACACCAATACATGTGATAGGCT
GAAAGGATCCACCCAATGGAGCAGGACTTGTTCTAGATGCAGATTAAAATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTATTCATCTTCTATCGGCAGTTATGCACCTGCAGTCAGTTTTGCAAGGTAGTTCAAAATGTGGATATACTCAACAATCATCCCGACATGGATTTTTCTCAACCAAAGCAACCACA
ACCAACCCCCTCTCTGTGTCGAACGCACGTGCAAGTGCTGCAGTGCAACTGAAACTCGTTGTAAATCGAGCACCTCCGCTTCTGGCATTCAGGATCATTTGGGGGCTTAATGCGCTAACA
TTTGCATTCCACATCAACCAGGCCACTCGCAGCAACACCATGGCTGCTACAGCAATAGCAATACGAACCTTCACAAACGCCGCTGCTCTTAGCAGGGGAGGGACAAACCTCTGGAGCACT
TACTCCCGCTCTCTGGCAACGCTCGTTCCAAGCCACATTCGCGGCGTCGCTGCAGTGAGGACACTGCCCACATTCGGATCCCGAGCGGCGACCACCATCGCGGAGGGCAGCAAGCTCCCC
GACGCCGAACTCTCGTATTTCGACAAGGAGGGTAACGTAAACATCGTCAAAGTCTCGGACCTCATGCGTGCCAAGAAGGTAGTCCTCTTCGCAGTCCCCGGCGCCTTCACCCCGACGTGC
TCCACGCAGCACCTTCCCGGATTCGTGGCCAAGGCGGACAAACTGCGGAAAGCAGGCGCGGATTTGCTGGCGTGCGTGAGCGTGAACGACGCCTTCGTGATGCGAGCGTGGGGGGAGAAT
CAGAACGTGGGCGAGAGTGTGTTGTTGCTGTCGGACGGGCTGGGGAAGTTCACGCACGCGATGGGCGCGAGCGTGGACCTGAGCGACAAACCCGTGGGGTTGGGGGTGCGGTCGCGGCGG
TATGCGATGCTGGTGGACGACGGCGTGGTGAAGACGCTGCATATGGAGGAGGGCGGCGCCTTCACCAGCAGCGGCGCCGACGACATCCTCAAGGCCTTGCTCAAGCGCAAGACCAGCGCC
GCCACCGCGCCCGAGTGCGCCAACCAGAACACCACG
GATTTGAGGCTCATTCTTGATGCAATGCTCCTACAACCTCAGCTCAAAGAAACTGCTCATGAGTTTGTCTTCAAGTTTGGCACC
ACAACCATCACAATCATTGTAACCATACCCACACAACACACCAATACATGTGATAGGCTGAAAGGATCCACCCAATGGAGCAGGACTTGTTCTAGATGCAGATTAAAATAA

Retrieve as FASTA