Entry information : CreAPx-R (Cre06.g285150.t1.1)
Entry ID 7433
Creation 0000-00-00 (Christophe Dunand)
Last sequence changes 2011-04-11 (Catherine Mathe)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: CreAPx-R (Cre06.g285150.t1.1)
Name (synonym) CreAPx-R (Cre06.g285150.t1.1)
Class Ascorbate peroxidase related    [Orthogroup: APx-R001]
Taxonomy Eukaryota Viridiplantae Chlorophyta Chlorophyceae Chlamydomonadaceae Chlamydomonas
Organism Chlamydomonas reinhardtii    [TaxId: 3055 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CreAPx-R
start..stop
S start..stop
VcaAPx-R 346 2e-119 52..337 40..324
CvarAPx-R 271 8e-90 69..337 81..350
CsorAPx-R 267 1e-88 111..337 97..319
OCgAPx-R02 258 2e-86 121..332 1..209
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4209763..4209886 124 N° 2 4209317..4209540 224 N° 3 4208686..4208832 147 N° 4 4208241..4208493 253
N° 5 4207936..4208033 98 N° 6 4207406..4207483 78 N° 7 4207005..4207094 90  
complement(join(4207005..4207094,4207406..4207483,4207936..4208033,4208241..4208 493,4208686..4208832,4209317..4209540,4209763..4209886))


exon

Literature and cross-references CreAPx-R (Cre06.g285150.t1.1)
DNA ref. Phytozome 12:   chromosome_6 (4209886..4207005)
EST ref. GenBank:   BI718422.1 [5' end]   BI995259.1 [3' end]
Cluster/Prediction ref. UniGene:   Cre.3578
Protein sequence: CreAPx-R (Cre06.g285150.t1.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   337
PWM (Da):   %s   35018.22  
PI (pH):   %s   8.97
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSTSVLSHRSLSNCTRHGNPRRACRVATHAKLRDLSQWRQEGSGTSEPAVAPELSRRAVLKLGAALPALAAALAAATPPALLLAPLPAAAEGPTLPSPAVAAALDKALAKNIPKTTAVALRLAFHDAATFSAGAKDGGLNASIQYELDRPENFGLKRGWRIIEQVRADLKGTAAEGVVTDADLVALAGAFAVRLCGGPAIPLPIGRPVAAAARQDPPGRMPSENASAAELKANFAAKGLSVQEMVALSGAHTLGSKGFGDPVTFDNAYYVALLQKPWNNTDAMASMIGLPSDHVLPDDPDCLPVIQRYAADQDLFFRDFSAAYIKMCGLGVAGWA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6, 7 introns) and 19 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTACAAGCGTCCTTTCGCACCGTTCCCTGTCGAATTGCACACGCCATGGCAACCCGCGACGAGCGTGCAGAGTTGCGACGCATGCCAAGCTACGGGACCTGTCACAGTGGCGCCAA
GAGG
GTGCGTGGCGGATGTTCGATGGGCCGCAGCTCGGGCGTAACTGTACCCCTCGGGATGGTACCCGTGGCCACGATGCCCCGCCGGCAACTGGCGCATGCACCGGAGGGAGGCGAGCG
CAGGGGATGCGAGCTCTTAGATAGCTAGTAACTAGTACGTACGTCGTTGCCTGCCGTCACGGTCGCGCCCCGGGCATCGCGGTTGCGTCACGCCTGACTAGGACAGGCAGCGGTACCTCG
GAGCCGGCTGTAGCTCCGGAGCTTTCGCGACGAGCGGTGCTGAAGCTGGGGGCGGCACTGCCGGCCCTGGCGGCGGCTCTGGCCGCGGCCACCCCGCCGGCGCTGCTGCTGGCGCCACTG
CCGGCCGCCGCCGAGGGGCCGACGTTGCCGTCTCCGGCCGTGGCGGCTGCGTTGGACAAGGCTCTTGCTAAGAACATCCCCAAGACGAAG
GTGCGTGAGAGGGTGCGAGTTACGAGGACC
AAATTTGCAAGGGTGTGCAACAGTGGCGGGTCTACTTGGGGCAGTGGGGGAAGCAGGGCGCAGCGGGTGGGCGAGGCAGGACGGTGCCACTTTGCGGAGGCACGGCACGGCGCCTCAGGG
CCGCGCTGGTGAGTGGTGCCCCCACCATCCCGGTCCGGTGTTGGTGATCTGGATGCGGCTCAGTTCGCATGATGCGCCCGGATGCCCTCTGTTGCTCCCCCTACTCCATGAACCTTGATA
TGTGTGGTCTCGCGGCCTCCTGCCCCCCGGCACCGCCAACCCGTACCCACCCCAATCTCCTGTTCCCTGCTCCACGGCTCACACACACACACACACACACACACACACACACACACACAC
ACACACACACACACACACACACACACACACACACACACACACATGCACATGCACACACACGCACACGTTCCCCTTGTGCTCTCCGCACGCACAGACTGCTGTGGCTCTGCGCCTGGCCTT
CCACGACGCCGCCACCTTCAGTGCGGGCGCCAAGGACGGCGGCCTGAACGCCTCCATCCAGTACGAGCTGGACAGGCCCGAGAATTTCGGGCTCAAACGCGGCTGGCGCATCATTGAGCA
G
GTGTGCGTGCGGGGGCTATGCGGGGGCGGGCGATGGCAATCAATTTTACCATTTGCAATAAGCGACAAGCGGCATGAAAGAAGCAGAACAGCAGCCGAGGGTGGGGCTGTTTTCCCAGC
CTCCAGATAGATCCAGTGCCGCCAACCCACTCCCCTCTCCTCCCCTCGCCACCGCCACCCCCCCCCCCTCCAGGTGCGCGCGGACCTAAAGGGCACGGCGGCGGAGGGCGTGGTGACCGA
CGCCGACCTGGTGGCCCTGGCCGGCGCCTTCGCGGTGCGGCTGTGCGGCGGCCCTGCCATCCCACTGCCCATCGGCCGCCCGGTGGCGGCGGCCGCCCGCCAGGACCCGCCTGGCCGCAT
GCCGTCCGAGAACGCCAGCGCGGCCGAGCTCAAGGCCAACTTCGCGGCCAAGGGGCTGAGCGTGCAGGAGATGGTGGCGCTGTCAG
GTGAGGGGGAGAGAGGGAGGGCGAGGGAGGGGGG
AGGAAGGGGGAGGAAGGGGGAGGAGGGGGGAGGGCGTGGGAGGGCATGGGGAATGGGGGAGGAATTGGGGGTGGGGAAGGGGGGAGGGCTCTGCTCCTCGGGCCCACCCTCTCACCCAGC
CAAGCCACACACACCACCGGCGCCATCTTAAGGTCCGCCACTCCACCACGCAGGTGCTCACACGCTGGGCAGCAAGGGCTTTGGCGACCCGGTCACCTTTGACAATGCCTACTACGTGGC
GCTGCTGCAGAAGCCCTGGAACAACACAAAG
GTGCGCGGGAGGGCGGGGGCGGCTGCGGGGAGGGCGGGGGCGGCTGCGGGGAGGGCGGGGGCGGCTGCGGGGCGGGCGGGGGCGGGGGC
GGAAATGGCGGCTGGGGCGGGCGGGGTTGCGGGGGTTGCACACACGGGCGTGTGGTTGCATCACGTCTTGTGTGGCACCTTCCGCGCCTGATGCCTCCAGCCGCCGCCGGTGGGTGTCTT
CATCCGCCACGCCAGGCAGCACCCGGGCCTGGGCGCCTCCCACTGCTCCCCTCCGCCTTTGTCGCCTACCGTGTTGCAACATCCCACCTTTTCCCTGTCCGCCCGCCAATCCGCACGCCC
TCCCGCCCGCCTGTTGTGTATGCCACCTCCCCCCTTGCGATTCTTCACTTGAACGACTACCTCGCTACGCTTCCCTGTAACATCTTGCAACCCCCACACGCCACGCCCACCCCACCCCCT
CAGGACGCCATGGCCTCCATGATCGGGCTGCCCTCCGACCACGTGCTCCCTGACGACCCGGACTGCCTGCCCGTCATCCAGGTGGGTGGGGCCCTCAGGGGCCGCAGGGGCCCTCAGGGG
CCGCAGGGGCCGCAGCGGCCGCAGGGGCCGCACGGGCCTGTGGGTGTGTTGGCCGCTGGCCAGAGAGGAGCTGCAGCAAGGCTTGAGGTTGGGTGCATGCCCAGCCGCTCACGCCTGGCA
GGTGCCTTCCCCCAGGCCCCGCCTCCGCAATGCGCCCTCCGCTGCTCCTCCTGCCCCCACCCCCCACGCGCGCTATACTAACTGTTCGTGGCTATGCCTTCACTTCTTAAATCATCATTG
AATGTACCCCCCCCCATACACACACTGCGCAGCGTTACGCGGCGGACCAGGATCTGTTCTTCCGCGACTTCTCCGCCGCCTACATCAAGATGTGCGGGCTGGGCGTGGCGGGCTGGGCGT
GA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTACAAGCGTCCTTTCGCACCGTTCCCTGTCGAATTGCACACGCCATGGCAACCCGCGACGAGCGTGCAGAGTTGCGACGCATGCCAAGCTACGGGACCTGTCACAGTGGCGCCAA
GAGG
GCAGCGGTACCTCGGAGCCGGCTGTAGCTCCGGAGCTTTCGCGACGAGCGGTGCTGAAGCTGGGGGCGGCACTGCCGGCCCTGGCGGCGGCTCTGGCCGCGGCCACCCCGCCGGCG
CTGCTGCTGGCGCCACTGCCGGCCGCCGCCGAGGGGCCGACGTTGCCGTCTCCGGCCGTGGCGGCTGCGTTGGACAAGGCTCTTGCTAAGAACATCCCCAAGACGAAG
ACTGCTGTGGCT
CTGCGCCTGGCCTTCCACGACGCCGCCACCTTCAGTGCGGGCGCCAAGGACGGCGGCCTGAACGCCTCCATCCAGTACGAGCTGGACAGGCCCGAGAATTTCGGGCTCAAACGCGGCTGG
CGCATCATTGAGCAG
GTGCGCGCGGACCTAAAGGGCACGGCGGCGGAGGGCGTGGTGACCGACGCCGACCTGGTGGCCCTGGCCGGCGCCTTCGCGGTGCGGCTGTGCGGCGGCCCTGCC
ATCCCACTGCCCATCGGCCGCCCGGTGGCGGCGGCCGCCCGCCAGGACCCGCCTGGCCGCATGCCGTCCGAGAACGCCAGCGCGGCCGAGCTCAAGGCCAACTTCGCGGCCAAGGGGCTG
AGCGTGCAGGAGATGGTGGCGCTGTCAG
GTGCTCACACGCTGGGCAGCAAGGGCTTTGGCGACCCGGTCACCTTTGACAATGCCTACTACGTGGCGCTGCTGCAGAAGCCCTGGAACAAC
ACAAAG
GACGCCATGGCCTCCATGATCGGGCTGCCCTCCGACCACGTGCTCCCTGACGACCCGGACTGCCTGCCCGTCATCCAGCGTTACGCGGCGGACCAGGATCTGTTCTTCCGCGAC
TTCTCCGCCGCCTACATCAAGATGTGCGGGCTGGGCGTGGCGGGCTGGGCGTGA

Retrieve as FASTA