Entry information : OsPrx[P]75
Entry ID 7440
Creation 2010-07-16 (Christophe Dunand)
Last sequence changes 2010-08-04 (Christophe Dunand)
Sequence status theoretical translation / pseudogene
Reviewer Not yet reviewed
Last annotation changes 2010-08-04 (Christophe Dunand)
Peroxidase information: OsPrx[P]75
Name OsPrx[P]75
Class Class III peroxidase    [Orthogroup: N/D] N/D
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx[P]75
start..stop
S start..stop
OsPrx75 182 6e-59 4..94 37..127
OsPrx[P]75-2 166 4e-56 1..94 1..83
BdiPrx70 156 7e-49 3..94 35..126
TaPrx80 154 1e-48 4..94 34..124
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3594472..3594618 147 N° 2 3594256..3594390 135  
complement(join(3594256..3594390,3594472..3594618))


exon

Literature and cross-references OsPrx[P]75
DNA ref. GenBank:   NC_008397.1 (3594618..3594256)
Protein sequence: OsPrx[P]75
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   94
PWM (Da):   %s   10567.15  
PI (pH):   %s   6.5
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GPGCRWGSTMPSALSRRTSCWAR*G*SSRRIPRSRRLCTGCITTTALSRGVTYRLC*GRGAERGRGTRRPTGACEATTPSIRSRRGWRASARSP

Retrieve as FASTA  
Remarks Pseudogene. Sequence from genomic (chromo 4, intron 1). PS and exons 3 and 4 are missing.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGCCCGGGCTGCAGGTGGGGTTCTACCATGCCAAGTGCCCTGTCGCGGAGGACGTCGTGCTGGGCGAGATGAGGATGATCCTCGAGGAGGATCCCACGCTCGCGCCGTCTCTGCACCGGA
TGCATTACCACGACTGCTTTGTCCAGG
TAATTAACAATTTTAATTGCCCAGGCTCAAGCTACTTCCTGCTCGTCCATGGCTATCGATCATCTGAGTGTTGGTTGCAGGGGTGTGACGTAT
CGATTATGCTGAGGTCGAGGAGCGGAAAGGGGGAGAGGGACGCGACGCCCAACCGGAGCATGCGAGGCTACGACGCCATCAATCAGATCAAGGAGAGGCTGGAGAGCATCTGCCCGCTCA
CCT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGCCCGGGCTGCAGGTGGGGTTCTACCATGCCAAGTGCCCTGTCGCGGAGGACGTCGTGCTGGGCGAGATGAGGATGATCCTCGAGGAGGATCCCACGCTCGCGCCGTCTCTGCACCGGA
TGCATTACCACGACTGCTTTGTCCAGG
GGTGTGACGTATCGATTATGCTGAGGTCGAGGAGCGGAAAGGGGGAGAGGGACGCGACGCCCAACCGGAGCATGCGAGGCTACGACGCCATCA
ATCAGATCAAGGAGAGGCTGGAGAGCATCTGCCCGCTCACCT

Retrieve as FASTA