Entry information : OsPrx5556 (x / OS04G42100)
Entry ID 7444
Creation 2010-07-16 (Christophe Dunand)
Last sequence changes 2010-07-16 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: OsPrx5556 (x / OS04G42100)
Name (synonym) OsPrx5556 (x / OS04G42100)
Class Class III peroxidase    [Orthogroup: Prx030]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx5556
start..stop
S start..stop
SiPrx57 522 0 155..508 19..371
ZmPrx95 512 5e-180 196..508 159..472
BdiPrx130 506 2e-177 201..508 194..496
SbPrx93 492 1e-173 120..508 3..376
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 24898779..24899534 756 N° 2 24897777..24897956 180 N° 3 24896462..24896627 166 N° 4 24895923..24896347 425
complement(join(24895923..24896347,24896462..24896627,24897777..24897956,2489877 9..24899534))


exon

Literature and cross-references OsPrx5556 (x / OS04G42100)
DNA ref. GenBank:   NC_008397.1 (24899534..24895926)
EST ref. GenBank:   CI311200.1 [5' end]
Cluster/Prediction ref. UniGene:   Os.5796
Protein sequence: OsPrx5556 (x / OS04G42100)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   509 (482)
PWM (Da):   %s   51450.89 (48327.3) Transmb domain:   %s   i12-34o
PI (pH):   %s   8.93 (8.66) Peptide Signal:   %s   cut: 27 range:27-508
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDQMRRQRRRECIGVLCSALFFSVLAVAVAAGSGSSSQPPSSSPAPAASSATPAARAPSQRTPPTPATPAKAASPPATNSSSSPRTPAAPAPRPPQPPPATSPAPTKPSSPPAPKPPSPPAPSPSTTPSSPPAPKPSSPPPAATPTTKPSPPPSSPPAPRPSPPLPPRTPPPPPPAAAPKPSPSPPPAPTNSTTNSSSPSTSTPVQLSPNFYAQSCPSVELAVRDVVRSASTLDSTIPGKLLRMLFHDCFVEGCDASVMIEGSGTERTDPANLSLGGFNVIDAAKRLLEAVCPVTVSCSDILVLAARDAVTFTGGPLVPVSLGRLDGLVSLASNVRANIIDTGFSVDAMARSFSAKGLTLDDLVTLSGGHTIGSAHCTTFGERFRVDANGSTVPADAAMNADYAGGLIRACSAVNNTVSSTAAVDCDEGSASRFDNAYFANLLAGRGLLRTDAVLVQNATTRATVEAFARSEGSFFASWAASFARLTSLGVRTGADGEVRRTCSRVNG

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, 3 introns) and 50 ESTs. Very long PS confirmed with ESTs. Similar sequence found in indica. Not predicted from Phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCAGATGAGGCGGCAGCGGCGGCGGGAGTGCATTGGTGTTCTTTGCTCGGCGCTGTTTTTCTCTGTCCTGGCAGTGGCCGTCGCCGCAGGCTCCGGCTCGTCGTCGCAGCCGCCG
TCTTCGTCTCCGGCGCCAGCTGCTAGCTCAGCAACGCCGGCTGCGAGGGCGCCTTCTCAACGGACGCCGCCGACGCCAGCAACGCCGGCAAAGGCGGCATCCCCACCGGCGACGAACTCG
TCGTCCTCTCCACGGACACCCGCGGCGCCAGCCCCGAGGCCTCCACAGCCGCCACCGGCGACGTCGCCGGCGCCAACAAAGCCGTCGTCTCCACCCGCGCCGAAGCCACCTTCCCCTCCT
GCGCCGTCGCCGTCCACAACGCCGTCGTCTCCACCCGCGCCGAAGCCATCTTCTCCTCCTCCTGCGGCGACGCCGACCACAAAGCCGTCTCCTCCACCGTCCTCGCCACCGGCTCCGAGA
CCGTCTCCTCCTCTTCCTCCTCGGACGCCACCGCCACCGCCGCCGGCAGCGGCACCGAAACCATCTCCTTCTCCTCCTCCGGCTCCAACGAATTCCACGACGAACTCCTCCTCGCCGTCG
ACGTCCACGCCGGTCCAGCTCTCGCCAAATTTCTACGCGCAGTCCTGCCCGAGCGTGGAGCTGGCGGTGAGGGATGTCGTCAGGTCGGCCTCCACATTGGATTCCACCATCCCCGGCAAG
CTTCTCAGGATGCTCTTCCATGACTGCTTTGTTGAG
GTAAGAAACTACTGATGCCATGACTGTTTATCTCAGAATCTAGTAGTATACTGCTTGCATTTGTCAAATGCGTCACATTGGCTG
CAATTTGCAACAATGGAAGTTCTTGTGCATGCAAGCAAATGGTGAAATGGCTGTCTGCAATGTAGATGGTTATATGAATCACATCCAAGTGTGTAGATCTAGCCATCAACAATTCCTGTT
CCATCACACTGGATTGGGGTATTGCCATTTGCCGTCTCAGTTTTTCATATTCTCAGAAATAACAATGGTGGGGTGGAAATATAATGCAGTAATGTGTTTTTGTTCAATTTTATGATGATA
TATAGTTCCTTCGGCCCAATTTACTAGCAGCTGAATAATAGTTATTTTCATCCGTTTTCTTAGTTTGAAATGCTGAAGACCTGAAGAACTAATCAAATGCTCATTCTACTAGTTAGTTTA
GGATATTCCTTTTCTCACCCTAGTTTTCCCCAGAATAGTTATGACATGTGTGGCACTAATTGCATCGGCTAATAATCTGGCATTATTCGAATATAATGTATATCTTGTCGATTGAATGGT
CCAGTCTAGAATAGTTATTGATCACTAAGCTATGTGGTGGCTAAAATTAAGACCCTAATCCATTATGCACGCTTGGTATAACCAAACATAATGTAGTTTTCCACAGCTTGCACATTGTCA
CTGCCACAATTATGGGAACAATTGTATTTGTCTTGCATTTGCATCTCATCGGGTTTAAGAATTGTGAAAACATCCACGCTTGCACAATAACAGAAAGTGAGAAAGTCATTCTTAGAGTAC
ATTTTTTCTTGGTCTCAGGGATGTGATGCATCAGTGATGATTGAAGGTAGCGGCACGGAGAGGACCGATCCTGCAAACCTCTCACTTGGTGGGTTCAATGTCATAGATGCTGCCAAGAGG
CTGCTTGAAGCCGTGTGCCCTGTAACTGTTTCCTGCAGCGACATTTTAGTCCTTGCCGCAAGAGATGCTGTTACATTT
GTAAGTATGATGGCACTATGTGATTTCTCTTTTCTAGTTGCT
ACAATCCACTCAAAGGTAAATGTGCCAAATATTTAAATTGTTGCCTGAGATGAATTTTCCTAGAAATGTTGCTACTAAATATAGTTAAGCAGATGTAGTACTCTTCATAAGCATAGGACA
TCAGAAATAATCCACATTAATGCTGCAACAGTTAGATCTTTAATCATCCAATGAATTGAGTGCTCCTGGTCCATGCATACGTTACACGACTATACCTTGGAAAATAATTAGAACTACTAT
GGTTACACCCAAATAAAATCAGACAGGTAGACCATCATGAACTTAACTAAGTGAACACAATTCCGTTTCCATTAGTTTCATGATTGTCATCTTATGTCGTTGGACCACAATATTTTATGT
GCGTAATTCTGTGGGGGACATGATTAATGGTCCTAAGGGGATTGATGAAATGAGCTAATGAAGGGGGGCACAACTGGAATAGTTTTTCATTGTTTAGTAGCTTCTTCTTTCCTCTCTCTT
TCTCTCTTTCACTGTTTTGGTGATCTTGTAAATACTTTTTTTCTCCCCTGCTTAATATAACACCAGCTTTGCTGGCTTCGGTTTTTTTATAAAAAAAACAACTGGAATAGTGAAACTTAA
GAACAGATATGCTTTGAAACTACATTCCTCTGTATCTAGAAATACAGAGTTTGCAGTAACATTCACACTCACATTCACCTTCACCATTTCACCCACATCATATAGATGTTGATTCGGCAT
AGACTTGGTAACAAAAAAGAAATACAGCAAGACTTATAATATGGTTGTTTCTACGGAAATGTTTCTCTAAACTTCAACACCCTCGTTTTCCATTAGCATATGCTTCCCAAACTGCTAAAC
CGTGTTTTTTTTTTGCAAAAACTTTTTATATAAAAGTTTCTTTAAAAATTCAAATGAACCCTTTTTCAATTTTATATTAATTAATAATTAATTAATCTTGTGTTAATTGCTTGCTCCGGT
TTCTGTGCCACTTAAAAGCTCAATTTTTAGTCTTGGCACAAAATCCTATTGGCATGTTAGGGCAGATTGGTTTACAAAGCAGATAAACTACCAATGTAAAATGAGTGACATTCATGAACT
AACATGCATTCACCTGCTGCAAACCAGACCGGAGGACCGTTGGTGCCAGTCTCTCTCGGGAGGCTCGACGGCCTGGTCTCGCTGGCCTCCAACGTCAGGGCGAACATCATCGACACCGGC
TTCTCCGTCGACGCCATGGCGAGGAGCTTCTCCGCCAAAGGGCTCACCCTGGACGACCTCGTCACCCTCTCAG
GTACACACACACACGCTCTTGAATGCTGGAGGATCAACTGCGATTTT
CACTTTTCACCTGGTCTCACCGTGAGCACACGGCTGTCGATCGCCGGCGTGGCGCACTGGCGCGCAGGGGGGCACACCATCGGGTCGGCGCACTGCACGACGTTCGGGGAGCGGTTCCGG
GTGGACGCGAACGGGAGCACGGTGCCCGCGGACGCGGCGATGAACGCGGACTACGCCGGGGGGCTGATCAGGGCGTGCTCGGCGGTGAACAACACGGTGTCGTCGACGGCGGCGGTGGAC
TGCGACGAGGGGTCGGCGTCGCGGTTCGACAACGCCTACTTCGCCAACCTGCTCGCCGGGCGCGGGCTGCTGCGCACGGACGCCGTGCTGGTGCAGAACGCCACGACGCGGGCCACGGTG
GAGGCGTTCGCGCGGAGCGAGGGGAGCTTCTTCGCCAGCTGGGCGGCCTCGTTCGCCAGGCTCACCAGCCTCGGCGTCAGGACCGGCGCCGACGGCGAGGTCCGCCGGACGTGCTCCCGC
GTCAACGGCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCAGATGAGGCGGCAGCGGCGGCGGGAGTGCATTGGTGTTCTTTGCTCGGCGCTGTTTTTCTCTGTCCTGGCAGTGGCCGTCGCCGCAGGCTCCGGCTCGTCGTCGCAGCCGCCG
TCTTCGTCTCCGGCGCCAGCTGCTAGCTCAGCAACGCCGGCTGCGAGGGCGCCTTCTCAACGGACGCCGCCGACGCCAGCAACGCCGGCAAAGGCGGCATCCCCACCGGCGACGAACTCG
TCGTCCTCTCCACGGACACCCGCGGCGCCAGCCCCGAGGCCTCCACAGCCGCCACCGGCGACGTCGCCGGCGCCAACAAAGCCGTCGTCTCCACCCGCGCCGAAGCCACCTTCCCCTCCT
GCGCCGTCGCCGTCCACAACGCCGTCGTCTCCACCCGCGCCGAAGCCATCTTCTCCTCCTCCTGCGGCGACGCCGACCACAAAGCCGTCTCCTCCACCGTCCTCGCCACCGGCTCCGAGA
CCGTCTCCTCCTCTTCCTCCTCGGACGCCACCGCCACCGCCGCCGGCAGCGGCACCGAAACCATCTCCTTCTCCTCCTCCGGCTCCAACGAATTCCACGACGAACTCCTCCTCGCCGTCG
ACGTCCACGCCGGTCCAGCTCTCGCCAAATTTCTACGCGCAGTCCTGCCCGAGCGTGGAGCTGGCGGTGAGGGATGTCGTCAGGTCGGCCTCCACATTGGATTCCACCATCCCCGGCAAG
CTTCTCAGGATGCTCTTCCATGACTGCTTTGTTGAG
GGATGTGATGCATCAGTGATGATTGAAGGTAGCGGCACGGAGAGGACCGATCCTGCAAACCTCTCACTTGGTGGGTTCAATGTC
ATAGATGCTGCCAAGAGGCTGCTTGAAGCCGTGTGCCCTGTAACTGTTTCCTGCAGCGACATTTTAGTCCTTGCCGCAAGAGATGCTGTTACATTT
ACCGGAGGACCGTTGGTGCCAGTC
TCTCTCGGGAGGCTCGACGGCCTGGTCTCGCTGGCCTCCAACGTCAGGGCGAACATCATCGACACCGGCTTCTCCGTCGACGCCATGGCGAGGAGCTTCTCCGCCAAAGGGCTCACCCTG
GACGACCTCGTCACCCTCTCAG
GGGGGCACACCATCGGGTCGGCGCACTGCACGACGTTCGGGGAGCGGTTCCGGGTGGACGCGAACGGGAGCACGGTGCCCGCGGACGCGGCGATGAAC
GCGGACTACGCCGGGGGGCTGATCAGGGCGTGCTCGGCGGTGAACAACACGGTGTCGTCGACGGCGGCGGTGGACTGCGACGAGGGGTCGGCGTCGCGGTTCGACAACGCCTACTTCGCC
AACCTGCTCGCCGGGCGCGGGCTGCTGCGCACGGACGCCGTGCTGGTGCAGAACGCCACGACGCGGGCCACGGTGGAGGCGTTCGCGCGGAGCGAGGGGAGCTTCTTCGCCAGCTGGGCG
GCCTCGTTCGCCAGGCTCACCAGCCTCGGCGTCAGGACCGGCGCCGACGGCGAGGTCCGCCGGACGTGCTCCCGCGTCAACGGCTGA

Retrieve as FASTA