Entry information : OsPrx4849 (Os03g32050 / OsPrx48-49)
Entry ID 7445
Creation 2010-07-16 (Christophe Dunand)
Last sequence changes 2010-07-16 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: OsPrx4849 (Os03g32050 / OsPrx48-49)
Name (synonym) OsPrx4849 (Os03g32050 / OsPrx48-49)
Class Class III peroxidase    [Orthogroup: Prx113]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx4849
start..stop
S start..stop
SbPrx14 475 2e-170 20..313 49..344
SiPrx157 469 3e-168 17..313 32..330
TaPrx33 468 3e-168 18..313 26..320
ZmPrx55 467 2e-167 16..313 41..342
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 18138004..18138195 192 N° 2 18137711..18137902 192 N° 3 18137138..18137303 166 N° 4 18131238..18131629 392
complement(join(18131238..18131629,18137138..18137303,18137711..18137902,1813800 4..18138195))


exon

Literature and cross-references OsPrx4849 (Os03g32050 / OsPrx48-49)
DNA ref. GenBank:   NC_008396.1 (18138195..18131241)
Protein sequence: OsPrx4849 (Os03g32050 / OsPrx48-49)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   313 (296)
PWM (Da):   %s   32027.8 (30324.9)  
PI (pH):   %s   4.46 (4.46) Peptide Signal:   %s   cut: 18 range:18-313
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVLLFLALATSSTVANAQLSDSYYDASCPAALLTIRTVVSAAVLLDPRMGASLLRLHFHDCFVQGCDASVLLDDTGSFTGEKGAGPNAGSLRGFEVVDNAKTLLETVCPQTVSCADILAVAARDAVVQLGGPSWTVLLGRRDSTTASASLANSDLPAPSSTLATLLAAFSNKGLTTTDMVVLSGAHTIGRAQCANFRDRIYNDTDIDASFAASLRAGCPQSGDGSGLAPLDESSPDAFDNGYFGGLLSQRGLLHSDQALFAGGGGSTDGLVRSYASSNDQFASDFSTAMVKMGNISPLTGSAGEIRVNCRAVN

Retrieve as FASTA  
Remarks Complete sequence fromgenomic (chromo 3, 3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCCTCCTGTTCCTTGCACTGGCCACCAGCAGTACAGTAGCCAACGCCCAACTGTCCGACAGCTACTACGACGCTTCCTGCCCGGCCGCGCTGCTCACCATCAGGACCGTCGTGTCG
GCGGCGGTGCTGCTCGACCCCCGCATGGGCGCCTCCCTCCTCCGCCTCCACTTCCACGACTGCTTCGTCCAG
GCAATTAAGCTATCCCTTGTTAATTCTCCTTCCCCTCCGGCCACCAGT
CGATCGTCTGGTCGTCGTCGATCTCGATTGATTGGCATGCATGTCTCATGTAGGGCTGCGACGCGTCGGTGCTTCTTGACGACACGGGCAGCTTCACCGGCGAGAAGGGCGCCGGGCCGA
ACGCCGGGTCGCTGCGCGGGTTCGAGGTGGTCGACAACGCCAAGACGCTGCTGGAGACGGTGTGCCCGCAGACCGTCTCGTGCGCCGACATCCTCGCCGTCGCCGCCCGCGACGCCGTCG
TCCAG
GTACGCACCTGGTGACCGTCTAGCGGACGGACGATCTCATCAATACTAGCTGACTAGATCGAGCACCTAGTATATATACATGGAGAATATACTCCCTCCGGTTTTTAATATACGA
CGCCGTTGACTTTTTCTCGCATGTTTGATCATTCGTCTTATTCAAAAAATTTACGTAATTATAATTTATTTTGTTATGAGTTGTTTTATCACTCATAGTACTTTAAGTGTGATTTATATC
TTATACATTTGCATAAATTTTTTGAATAAAACGAATGGTCAAACATGTGAGAAAAAGTCAACAGCGTCATCTATTAAAAAACGGAGGTAGTATATTTTAAGAAAAACCTTTTTGAGCATA
CTATATATGAGTATTGTTTGGTTTCTTTGTGGTGTGCATGCATGCATTGCAGCTCGGGGGCCCGTCATGGACGGTCCTCCTGGGGAGGAGGGACTCCACCACGGCGAGCGCGTCGCTGGC
CAACAGCGACCTCCCCGCGCCGTCCTCCACCCTCGCCACTCTCCTCGCCGCTTTCTCCAACAAGGGACTCACCACCACCGACATGGTTGTCCTCTCGG
GTACAGTACACGTACGCTTAAT
TATATGCTAATTAATGATCGCACGATCTCTTTGTCTAAACTAATCCAACACTATCCTAGAAATTAATCAGCACGTACCGTCTAGACGAAAATTAAATTAAGAGAAGAAATTTCTACATCA
ATATTATCGCTCCGAATGAATCACTCCTTCTACATAGGTCCATCTTTGCCTATTAAACATGGGGTACATGAGGGTAGCAAGTTCAAAATTCTCCGTACGTAGGATATGGGATTTCTCTTG
TATATATATATAATTCAAATATGCATGCATTCATGGATGGTCTTGGCTTTGACTCGATCTGCATCTCTAGTGCACATGGCATGTTGCAAAATTGAAGGGTCCCAAATTCATATATCTGAA
AGACTGAATATGCATTACATTATTATTAATGATATGCACCGATCAACCACAAAACTAGTGATGAATATGAACCATACAGTAAATTTCCATTTCAAAAACAACAAGCGTGAGTCACATAAA
GTAGTTAGATTTTGTACGTATGCGTGCGTGACAGCAGACATAAGTACGAACTCCATGCATATGCATGCATGCTTGTCTGTTCCATACTTCCATTAATAATTAATTCTGACTGGTGTGAGC
GCGATCTCCTCAGAAGCGTCCTAATGAGAGTATACGTTCATGCATATGCATCCACACAAAATACAAATCGTGGATCATGCACACATATGGCTAGTAGCAAAAGCTAGTCAAGGTTATGCA
TGAATTCATATATGATGCGTCGGCTTAATTGTCTGCATTCGCCTCAATTCAATACAGTACACAGTGATCTCAATAGTGATGATCGACGACGGCTGTCACCTTCGCTTTAGTTTGCAACCT
CTCGCAACACGTAACATGCCTCAACTATCTGCACAATGATCGATCGATCTCGATCAAGGTGACCACCTACCTAACTCTCAGAGTCTCAGTCGTTCACTATATATCGTGCATGGAACCACA
TTGCATGCATGTCAAATCATGTTGCCGCGATTGATCGATCACGAGAAATCAACACACATAGATACACAAATTTTAACAATTTCATCCTTTGCAAAAACTAATTTTATAAATAAACGCGGT
CAAAACTTATTTCAAAAATAACCTTCGTATGACGCTGAAATTTGACACCTCAGCGCCACGTCAACTGGCGTTGAATGCCGTGCCACTGCGGATAGGAGGCTGATTCGGCGTGCCAACGTG
CATTCAGCGCTGTGCTATTTAGCGTCGAGGTGTCTAAGTTCAGCGCTATACGATTTGACGCTGAACAAAAGGATCTTTTTTAAAATAAGTTTTGGCCACAGTTCATTTGTAAAATTAGTT
TTTGCAAAGGGTCAAATTCTCACATTTGTGCACAGAGATATGTATAGCTGTCTCACAGGAGATTTTCTTTTTATCCACTATGTTCAGACCGCACCTCCACTTCTTTTTCTTATCACTATT
CCGTACGTGCTCATTTCCTTGTTGACATTATTATTGGTGCACGTCAAATCACGAAACGGCTAATGGGCGATCGCTCGCCTGGCGATGGGGGCAGCGATCAATTCGCTCCCCCCTCCCTCC
ACCTGGTTTCATTTTTTGGCACCGCATTATTTTCCTATTTTAGTAAATTTATGCACCTAAAATTTATACACCTCAAGTTTACACATCTAAAGTTTAGAGACCCAAAGTTTATAAGTCAAA
AGTTTATATATCCGATTCAAATTTGAATTTGAATTCAAATATTTTTTATATATAGTATTTCTATATATCTAAATTTTATACACCTAAAGTTTATAGACCTAAAGTTTCTAAGTCAAAAGT
TTATATATCCGATTCAAATTTAAATTTGAATTCAAATATTTTTTTAATATATAGTATTTCTATACATCTAAAAGTTTATAGACCTAAAGTTTATAGACCCATTTCAAATTTGAATTTGAA
TTCAAATAATAGTTTATAGACCCAAAGTTTATAAGTAAAAAGTTTACATACCCATTTTAAATTTGAATTTAAATTCAAATATTAGTTTATAGACCCAAAGTTTATAGGTCAAAAGTTTAC
ATACCCGATTCAAATTTGAATTTGAATTTGAATTCAAATATTAGTTTATAGACCCAAAGTTTATAAGTAAAAAGTTTACATACCCGTTTCAAATTTGAATTTTAATTCAAATTTTTATGG
TGTAGTAGTAAGAGAAGAAGGGGAGGTAAAGTAGTAAGGGGGAGGGGCGGGTGATCGCTGGGGAGGGGAGGGAGCGATCACCCGCCTATTAGGATTACCCCGTCAAATCACCATATGCCC
ATATATGAAACTACATTATTCCCTCCGTTTCAAAATATAACAACTTCTCCACCAACATTCTCTTCCCAATCAATCACAACTCTCCGCCATTCACTTTTCCCACCTACCTCCACTATTTAT
CCAATCACAACTCTCCATCACTCACTTCTATCTACTTTCTTAATAACCGTGTCCAACCCTGAAACTTGTTATATTTTGGGACGGAGGGAGTATATTGGAGTACTATAAGAAATTATGGAA
AGCAAGGAACATATAATTTATCTTTTTAGTTCTTCGATGTTGTATAAAAACAACATGGCATGAAATTTAATTTTCAATTAGTTTGAAAAGTTTCTATAGGGTGATTTAAAAATACATTAT
TTAAAAAATATTAATTGCATATCCACACGAGTATTAATTGCATATATATATCTTACATTACTCCCCCAATAAATTGTGAAATAGCCTTGCACATAATAACCTATTATAAATTATTCCATG
AAATATTTAATAACCAAATCATGCATGCATTCCCATGGAGTAATTCTCTACTATTATAAAAATTAAAGATTTTTTTTCTGGTATTTTGTATGTCATCCGTGTATGAGTCGGTTTTTAAGT
TCGTTTGCTTTTGGAAATATATATCCATATTTGTGTCGGTTTTTAAGATCGTTCACTTTTGGTAATACAGAAAGAATCATATAAGAAATTTGTTTAAAAAAAACTCACATGCTAACTTGA
GACGTTCGGACTCCTAACTGCAGCTCATAATTTTCTAAAAATATATATATCCAAGCGAACTCCCACAATAAATTTCAAATTAACTAAACCATATAATAATAATAAGATTAAAAAATACTT
CACCCGTTGCACGGGTATTTTTTCTAGTTTTTTTAAAAGTATAATAGTTGCATATTTATGTGTTCTTCTGAAAATTTAAACCTTTGAAAAAGTGGCTACAATTTGTTTTTCTGATATATT
ACGGTATTCATTTAAACAAAATTCCAAGTGTGTCGTATTGTTTTGGAACATCCAAAAGGGTATAATGGTAATCTGGGGAAAAGCTTAAACAGTCAACTTGTTGACTAGACGACGGGGGCA
AAAGAAATGCACACGGTAAAAAAAGAAGAGAGAAGTGCCATTTTTCGATGTTTGAAGAAAGAGAGAATACGGTTGCAAAGCAAGTGATTAAAAAAAGGAAAAAGTACGAATTACCCCTCC
GAACTATCTTGGTCGTCCGAATTATCCCCCGAACCACAAAACCAGACATTCTTCATCCCAACTATACAAACCGGACGAATTACCCCCCTCGATCCAATCCACGGTGGTTTTGGTTTACGT
GGCGTACGCGTGTCAGCCTAGTCAGCATTCTATTTATTAAAAAAAGTGGGACCCACATGTTATACACTCGTAGTCTCTCTTCGTACTCTCTCTTCTCTCTCTCTCACAAAGGAGGGGTGG
CTGGGCGCCGGTGTCCGGCGGTATCGAGGGTAGGCGGGAGGCAGCAGCCGCGAACGAGCTAGCCGGCGGCGGCGGCGGGTGGAGGTGGGGGTGCCGTTGGAGCGGCGTAGCGGAGGGGGC
CTCGACGCCGGCCGTCCCGCCGCCGCCCTCGTCCTCCCCGCGCGCACGCTGCCGAGAGGGAGGGGGAGCGTGCCGCCCTTTCGCCGAGGAGGCACGGCGCCTGCGCCTGCTGGCGGTGGT
GTCGGCAGTAAAGGGCGTCGCCGCGCGGCGGCTGCACGTCGCGGAGGCCAAGATGGGCGCAGAGGGCAGGCATGGCTGGGCATCGCCAAGAACCACGAGGCCGCCGCCGCGGGCCTCCGC
GCCACTCTCGACCAGCTCCTTCCTGCTCCGCTGCCGCCGAGGGCGAGGGCGATGCCGAGGATGCACACTTGGGGAGAAGCCGAGAGGGGGGAGGGGGGAAGCCGCGCCGAGCTCCGTGCG
CCCGCGCCGTCACGTAGTCGTCTCTCCCTCTCTCTCTCTCTCTCTCTCTGTGCTCAGGCAGGTGGGCGACGATGAATCATCCTCGGGGAGGGCGCGGCGAGCGGCGCGCGTGGCGTGGAG
GGCACGGTGGGCGGCGCCGAGAAGGGCATTGGAGGCGGTGCGCTACGGCAACGAGTTCGCCGCCCATCCACGTCGTCCCCATCCACCGTCGTCGCCGTCAACCGGAGCCACACAGTCGCG
CCCGCCGCTGCTCGCCACCGGCCGGAGCGACCTAGCCATGCGCACCGCCACTCGCCACCCAGCTCCGCCCTCCGCCTTTGCGTTCGGCAGAGGAGCGGGAGGCTGGCGGCGGCGGAGGCG
GAGGGCGCTGCGCTGCTAGGGTTGGCGGAGAAGTCGGAGACGTAGCCGAGCGAGATGCCGACGATGTGGGACGCGTCACCGTCGTCGCACAACACGCCATGCGGGCCGGCGAGGCAGAGG
TCGTTGGGGAAGCTGACAAGTTTTCCCCTTCCCTTCTCTACTTCTCTCGTTGATGCGGTGGAGGCGGCGAACGGTCCGTGAGTCCGTCGTCCTGGTCATCGGCATCGTGGCCGTCCAACC
ACATCCGCCGGCGAACGCAGAGAATGCTCGGGCAACCGGCGATGGAGGCGGCGAGTTCGGGCGGTCGGCGGTGGAGGCGAAGGCAGAGTGCGTCGCGTTCGCCGCTGCCGCGTGCTCTCT
CTGCTCACCGAGAGAGAGCTAGAGAAGGAGGAGAGGAAAAAAAAGCTGACAAGTAGGCCCCACTGGTTTTTTTATTTGTTTATGCTGACTGTATCGCCACATGTGTGCTACGTAGGCTGA
AAACCGCTTCAAACCATGTTAGGGTGGTAATTTGTTCGGTCTTAAGAGTTTAAGGTGTCAAATGTCCGGTTTTTGAGTTTAGGGATACATCGGACGACCGCGATAGTTTAGAGGGGTAAT
TCGTACTTTTTCCTTAAAAAAATCATCTCCACATAGATCAATGACATCTTTATACTGATACTAAAACCGTCTGTAAGACTGTGATTATTGATTAATATCATTTCACATATATAAATGTTC
GATAAACTTTTGAATATTCGTGGCACGTTTTTCAAACTGTTAAACAGTGTATTTCGTGTGAAAATTTTCTATACTAAAGTTGTTATAAAATATCAGAATAATCTATTTTTTAAGTTCGTA
ATAATTAAAACTTAATTAGTTACACATAATTACACCTTGTTTCACGTGGAACACTTACTAGATTTTACCATTAATCGTCTTTACAGGAGCCCACACCATCGGGCGGGCGCAGTGCGCCAA
CTTCCGGGACAGGATCTACAACGATACCGACATCGACGCGTCGTTCGCGGCGTCGCTGCGTGCTGGCTGCCCCCAGTCCGGCGACGGCAGCGGCCTCGCGCCGCTGGACGAGTCGTCGCC
GGACGCCTTCGACAACGGCTACTTCGGCGGCCTCCTCTCCCAGCGCGGCCTGCTCCACTCCGACCAGGCGCTGTTCGCCGGCGGCGGGGGCTCCACGGACGGCCTGGTCAGGAGCTACGC
GTCCAGCAACGACCAGTTCGCCAGCGACTTCTCGACGGCGATGGTGAAGATGGGCAACATTAGCCCGCTGACGGGGTCGGCCGGCGAGATCAGGGTCAACTGCCGGGCGGTGAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCCTCCTGTTCCTTGCACTGGCCACCAGCAGTACAGTAGCCAACGCCCAACTGTCCGACAGCTACTACGACGCTTCCTGCCCGGCCGCGCTGCTCACCATCAGGACCGTCGTGTCG
GCGGCGGTGCTGCTCGACCCCCGCATGGGCGCCTCCCTCCTCCGCCTCCACTTCCACGACTGCTTCGTCCAG
GGCTGCGACGCGTCGGTGCTTCTTGACGACACGGGCAGCTTCACCGGC
GAGAAGGGCGCCGGGCCGAACGCCGGGTCGCTGCGCGGGTTCGAGGTGGTCGACAACGCCAAGACGCTGCTGGAGACGGTGTGCCCGCAGACCGTCTCGTGCGCCGACATCCTCGCCGTC
GCCGCCCGCGACGCCGTCGTCCAG
CTCGGGGGCCCGTCATGGACGGTCCTCCTGGGGAGGAGGGACTCCACCACGGCGAGCGCGTCGCTGGCCAACAGCGACCTCCCCGCGCCGTCCTCC
ACCCTCGCCACTCTCCTCGCCGCTTTCTCCAACAAGGGACTCACCACCACCGACATGGTTGTCCTCTCGG
GAGCCCACACCATCGGGCGGGCGCAGTGCGCCAACTTCCGGGACAGGATC
TACAACGATACCGACATCGACGCGTCGTTCGCGGCGTCGCTGCGTGCTGGCTGCCCCCAGTCCGGCGACGGCAGCGGCCTCGCGCCGCTGGACGAGTCGTCGCCGGACGCCTTCGACAAC
GGCTACTTCGGCGGCCTCCTCTCCCAGCGCGGCCTGCTCCACTCCGACCAGGCGCTGTTCGCCGGCGGCGGGGGCTCCACGGACGGCCTGGTCAGGAGCTACGCGTCCAGCAACGACCAG
TTCGCCAGCGACTTCTCGACGGCGATGGTGAAGATGGGCAACATTAGCCCGCTGACGGGGTCGGCCGGCGAGATCAGGGTCAACTGCCGGGCGGTGAATTAA

Retrieve as FASTA