Entry information : PtPrx24 (POPTR_0001s46290 / Potri.001G458700)
Entry ID 7448
Creation 2010-08-02 (Christophe Dunand)
Last sequence changes 2010-08-02 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtPrx24 (POPTR_0001s46290 / Potri.001G458700)
Name (synonym) PtPrx24 (POPTR_0001s46290 / Potri.001G458700)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx24
start..stop
S start..stop
PtPrx23 642 0 1..322 1..322
RcPrx77 501 0 1..322 1..323
MePrx109 495 1e-178 1..322 1..321
RcPrx85 486 4e-175 1..322 1..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 46680448..46680663 216 N° 2 46680739..46680930 192 N° 3 46681016..46681181 166 N° 4 46681298..46681692 395
join(46680448..46680663,46680739..46680930,46681016..46681181,46681298..46681692 )


exon

Literature and cross-references PtPrx24 (POPTR_0001s46290 / Potri.001G458700)
DNA ref. Phytozome 11:   scaffold_1 (46680448..46681692)
Omic ref. ePlant:   Potri.001G458700
Protein sequence: PtPrx24 (POPTR_0001s46290 / Potri.001G458700)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (297)
PWM (Da):   %s   34613.03 (31910.7)  
PI (pH):   %s   7.57 (7.25) Peptide Signal:   %s   cut: 26 range:26-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVSRLSLACVVFSLFLISSCFPCQAQLSSNFYDSTCPNALTTIRTAIRRAVSSERRMAASLIRLHFHDCFVQGCDASIMLDNSPSIDSEKFSFSNNNSIRGFEVVDDAKAQVESICPGVVSCADIAAVAARDASVAVGGPSWTVRLGRRDSTTASRSLADSDIPRATTSLVNLIGMFNGKGLSERDMVALSGSHTIGQARCVTFRGRIYDNSSDIDAGFASTRRRNCPSASGNGNNNLAPLDLVTPNSFDNNYFRNLIQRRGLLQSDQVLFSGQSTDSIVTEYSRNPSLFSSDFAAAMLRMGDIEPLTGSQGEIRRVCSVVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTCTCGTTTATCTTTAGCTTGTGTTGTTTTTTCATTATTCTTGATTTCCTCATGTTTTCCATGCCAAGCACAACTGTCTTCAAACTTCTATGACAGCACATGTCCGAATGCACTG
ACCACAATTCGTACTGCTATTCGGAGAGCTGTCTCGAGCGAGCGCAGAATGGCAGCATCCCTTATTCGTCTTCACTTCCATGATTGCTTTGTTCAA
GTAAATTACTCGATCGCTACAACA
TTAGTACTGATTTCAGTCTGGAACTGATATATATGTTTGCTTATATTGCAGGGTTGTGATGCTTCAATCATGCTTGACAATTCTCCTTCAATAGATAGCGAGAAATTCTCATTCAGCAAT
AACAATTCAATCCGGGGATTTGAAGTCGTTGATGATGCCAAGGCTCAAGTGGAGAGCATATGTCCTGGAGTTGTTTCATGTGCTGACATTGCTGCTGTAGCAGCCCGTGATGCATCTGTT
GCT
GTGAGTAACACATTCCCTGCTCGGAAAGCTTCTCATTCAAACGTGATCAATCTAGTTATAAGTTCGGTTTCTATCTATAATACAGGTTGGTGGACCATCATGGACAGTGAGGCTTGG
AAGAAGGGACTCCACCACAGCAAGCCGAAGCCTAGCTGACAGCGATATTCCTAGAGCTACAACTAGCCTTGTAAACCTAATTGGCATGTTCAATGGAAAAGGTTTGAGTGAAAGAGATAT
GGTTGCCCTTTCAG
GTGTGTGCCTAAATAAGAACATGAACAGTTCCAACAATTTTCTAGGGCTAAACATCTATCTAAACGCACGAATGTATTACCGTCAAGGTTTGACTAAAGATTTCAT
TTTGATACAGGATCACATACAATAGGCCAAGCAAGATGTGTGACCTTCCGAGGCAGAATATATGACAATTCAAGTGATATTGATGCTGGTTTCGCCAGCACCAGAAGACGCAATTGTCCA
TCTGCTTCCGGTAACGGAAATAATAATCTTGCTCCACTTGATTTGGTGACACCCAATTCTTTCGATAACAATTACTTCAGGAATCTCATTCAAAGGAGGGGGCTTCTTCAATCAGACCAA
GTGCTCTTTAGTGGTCAATCTACAGACAGCATAGTCACCGAGTACAGCAGGAACCCTTCACTTTTTAGTTCTGATTTTGCCGCTGCCATGTTAAGGATGGGAGATATAGAACCACTGACT
GGTTCTCAAGGAGAGATACGAAGGGTTTGCAGTGTTGTTAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTCTCGTTTATCTTTAGCTTGTGTTGTTTTTTCATTATTCTTGATTTCCTCATGTTTTCCATGCCAAGCACAACTGTCTTCAAACTTCTATGACAGCACATGTCCGAATGCACTG
ACCACAATTCGTACTGCTATTCGGAGAGCTGTCTCGAGCGAGCGCAGAATGGCAGCATCCCTTATTCGTCTTCACTTCCATGATTGCTTTGTTCAA
GGTTGTGATGCTTCAATCATGCTT
GACAATTCTCCTTCAATAGATAGCGAGAAATTCTCATTCAGCAATAACAATTCAATCCGGGGATTTGAAGTCGTTGATGATGCCAAGGCTCAAGTGGAGAGCATATGTCCTGGAGTTGTT
TCATGTGCTGACATTGCTGCTGTAGCAGCCCGTGATGCATCTGTTGCT
GTTGGTGGACCATCATGGACAGTGAGGCTTGGAAGAAGGGACTCCACCACAGCAAGCCGAAGCCTAGCTGAC
AGCGATATTCCTAGAGCTACAACTAGCCTTGTAAACCTAATTGGCATGTTCAATGGAAAAGGTTTGAGTGAAAGAGATATGGTTGCCCTTTCAG
GATCACATACAATAGGCCAAGCAAGA
TGTGTGACCTTCCGAGGCAGAATATATGACAATTCAAGTGATATTGATGCTGGTTTCGCCAGCACCAGAAGACGCAATTGTCCATCTGCTTCCGGTAACGGAAATAATAATCTTGCTCCA
CTTGATTTGGTGACACCCAATTCTTTCGATAACAATTACTTCAGGAATCTCATTCAAAGGAGGGGGCTTCTTCAATCAGACCAAGTGCTCTTTAGTGGTCAATCTACAGACAGCATAGTC
ACCGAGTACAGCAGGAACCCTTCACTTTTTAGTTCTGATTTTGCCGCTGCCATGTTAAGGATGGGAGATATAGAACCACTGACTGGTTCTCAAGGAGAGATACGAAGGGTTTGCAGTGTT
GTTAATTGA

Retrieve as FASTA