Entry information : ZmPrx49
Entry ID 745
Creation 2005-12-19 (Christophe Dunand)
Last sequence changes 2010-12-23 (Marie Brette (Scipio))
Sequence status complete
Reviewer reviewer name not stored
Last annotation changes 2010-12-23 (Marie Brette (Scipio))
Peroxidase information: ZmPrx49
Name ZmPrx49
Class Class III peroxidase    [Orthogroup: Prx071]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type Mixed tissues
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx49
start..stop
S start..stop
SbPrx62 612 0 1..355 6..357
BdiPrx66 526 0 9..355 8..355
TmPrx08 492 2e-176 8..351 6..351
TaPrx46 491 8e-176 8..351 6..351
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 37810502..37810735 234 N° 2 37807309..37808145 837  
complement(join(37807309..37808145,37810502..37810735))


exon

Literature and cross-references ZmPrx49
Literature Walbot,V., unpublished
Protein ref. UniProtKB:   B4FY83   B6U0D4 [Mismatch]
DNA ref. GenBank:   AC194477.4 (40357..36928)
mRNA ref. GenBank:   BT042071
Protein sequence: ZmPrx49
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   356 (325)
PWM (Da):   %s   37541.8 (34485.2) Transmb domain:   %s   i7-29o
PI (pH):   %s   5.17 (4.77) Peptide Signal:   %s   cut: 32 range:32-356
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRTRGGSGFAGLQVACVVAALCLLLPTGSRAQLQVGFYNTSCPNAEALVRQVVTAAFANNSGVAPGLIRLHFHDCFVRGCDASVLLSVNPAGGKTERESPANDPSLRGFDVIDAAKAAVERSCPRTVSCADVLAFAARDSVTLTGNLFYDVPAGRRDGRVSNETEANDNLLGPDSTAEILIDGFGKKNLSIEDMVVLSGSHTIGRSHCFSFLSTNRQRLANGTISPAYQALLEALCPPNPGQFTPNTTEIDVSTPTVLDNNYYKLLPLNLGLHFSDDQLIRNGTLAPFASAFAANETLWKDKFAAAMIKMGNIEVKTGTTDEIRLNCSVVNPSSSSSTAGVIEMLFPAADEVATSS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 8, intron 1) and 92 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGACGAGAGGTGGCAGCGGATTCGCCGGCCTGCAGGTGGCGTGCGTCGTCGCCGCCCTGTGCCTGCTCCTGCCGACGGGGAGCCGCGCCCAACTGCAGGTGGGGTTCTACAACACC
TCCTGCCCCAACGCCGAGGCGCTCGTGCGTCAGGTCGTCACGGCTGCTTTCGCCAACAACTCCGGCGTCGCACCCGGGCTCATCCGCCTCCATTTCCATGACTGCTTCGTCAGG
GTACGT
AAATAGATATATTGACAGTAAACATGCTTGTCGGCAGATCACTACACATGTACAGTGTGCATGTATTATAGTCTCTGCTTGATTTATTTGTCACGATTTTCATCTCTACACATCAAACGA
ATCCGTTCGTGACATAGATGGACATATCTCATATGCTATTCTTCATCCTATAAATGTTTGAATGAAAATATTAAGCTAGTATGAGACTTGGTAACATTCCAAATTCGAATTTTATTTTAT
TTTTCTAACTATGGTTATTCTATATATTTTATATTAAAATCACAGATTTTTGTTTATTACAATTTTCATAGGCACGATCTACAAATTTCAGCCATGAGGATACATGCAAATCCCTTTAAA
CAAAACTACAAATCGAACAAAACATGAATTAAATTGACACAAAGACAATTTAATAATTTATAATTATTTCTATAACTAAGCAAGCACAAAAATCAAGAGATTTTCACATAAAATCAAATA
AACAATTGTACAAAAACAATAAATTTATATTAGTTGAAGGTAGTACTACGATAGTATTGCACAAAATTATCATGAGATCCAGCCATATAAAAACATAGGAGAAGTGGTTAGTTATAGCAT
GGCCCACAGGAACAGTCGCAGATTGACCAATATATTGTACTATAAGTTACTTGCCACCTAACAAGAGATAATCCTACAAATATATGATTTTCAACCCAATGCCTGTTGCTATACTTGTTT
AGCCTTATGTGATGTGGAAATTGCAAAACATTGAACTACACTCCTTCCGTTCTCGAATATTTGCAGTTCGCTAGTTAGTTTATCTTTAGTTAAACTAAAACGCGATGAATAAAAAAGAAC
TGAGCGTATACTTTCATTGGCTGGATGTGTAGCATGCATCTAGCTGTAGCAGGAACGTTATACTTTCCACATCTGACCGGACGCCGCTCTCGTGCACGTTTAGTACTTCCCTCCAGCCTA
GTTTATTTGTCGTCCAGCGGGATATATAGCTATCTATCGACATGCTTATAGTGCCAGACTAGTTATTTGCATTCATTAATTTTTTGAATAGCGGTGCAAAAGGTTCATATAATTAAACTC
CAATAATAGTAACACATATTTCTCTAGCTATCTCTTGTCTCCACATTGTGAGCCACAGATTACGTAGAAGTTCCACCAACGACAAAACAAAGTTAATTGAATCGAGATCAGCGTACGCGC
GTAACAAAAAGAGGTTGTTTGTCTCTGTCATAAAAAAACTAAGCTTTGCGGAACACGTGGCACTGGTCATGAGTTGATCAGCTAGCGTTGTCAAACTTGGTTCTGTTTGAATAATAGATC
GTTCAACACAGTAACGAAAGCTCAGTCTGGATCCTGGGTAGAATATGCTCCCTCAACTCATGGTTTTTTTTCTTCAAGGATTATATAATAGCAACCCATGACAATCTTTATAACGTTATC
ATATCACATGTAACTAATTAAGAGTCTGGTCATATAATGAATATCTCATGATATAAACTATATATTTAATAATTGATTAATAATTGGTTCACCTCTTTGTCTCACAAGGTATCTTGGAGT
TCGTAAGCACTCCACTTTTAGCTAGCTATTAGCAAGCAGATGGCTTCCCTTTGTCGTCTCTCTTTATTTCTCTTTCTTCTGCATCACCATAAATTTTACGTGATATCTCTTACCGTCGGC
CTACGTCACCCTACTATACTTGCTCTAAGGTGTACTCCTAACGGTGAATCTAAAGTGAAACAAATGAGGGTGCATATGTCTTGAATGTGTATAGTAATATTTTATAGGTGATGCATATAC
GGTGAAACACTAGTTTATTTCACTAGTTTTGTAATTTTTTTGGGTGCATATGTCACTACCTAGCTTCGCCTCTGTGTACTCAATCCGTTTTAATTTATAAACCGTTTTGCTTTTTGGACA
CTAATTTAACAGAGTCGTCTTATTAAAAAATATAATTATTAGTTATTATTACTGTGACACCATTTAGTATATAATATACTTTAAGTATGGCTAAAAATAAATTAATTTTTTTAAAAAATA
AGTATTTTGAATAATACGAGCTGTTCAAAATTTGGTGTCAAAAAATCAAATGAATTATAAATTAGAATGGATGTAGTAGTATGTAAGAGTACTATGATTGGTACTATCAACATTTATTTA
CATGTTATTGACGAGCTCGAATAATAGTCCAGATGATGGTTGAGTGTGTGAATAATTAATGTCACGGTGCCACCTACCATGATGCATGCTTGACATTAACATAATGCCACGTTTACTAGT
CCAATCAATCAATGGTGAAAGCTAAACTTTTGTGTGGTCGGCTCGACTCGACCGATCGATTCACACGCAGGGTTGCGATGCCTCCGTGCTCCTGTCCGTGAACCCCGCCGGCGGCAAAAC
GGAGCGTGAGTCCCCGGCCAACGACCCGAGCCTGCGCGGCTTCGACGTGATCGACGCCGCCAAGGCCGCCGTGGAGCGGAGCTGCCCACGCACGGTGTCGTGCGCCGACGTCCTCGCGTT
CGCGGCCCGCGACAGCGTCACCCTGACGGGCAACCTCTTCTACGACGTGCCAGCGGGGCGGCGGGACGGCCGCGTGTCCAACGAGACGGAGGCCAACGACAACCTGCTGGGGCCGGACAG
CACGGCGGAGATCCTCATCGACGGCTTCGGGAAGAAGAACCTGAGCATCGAGGACATGGTGGTCCTGTCCGGCTCCCACACCATCGGCCGCTCCCACTGCTTCTCCTTCCTGTCCACCAA
CCGGCAGCGGCTGGCCAACGGGACCATAAGCCCAGCGTACCAGGCGCTGCTGGAGGCGCTGTGCCCGCCCAACCCGGGCCAGTTCACCCCCAACACCACGGAGATCGACGTCAGCACGCC
CACCGTGCTGGACAACAACTACTACAAGCTGCTGCCGCTCAACCTGGGCCTGCACTTCTCCGACGACCAGCTTATCCGCAACGGCACTCTCGCGCCGTTCGCCAGCGCATTCGCCGCCAA
CGAGACGCTCTGGAAGGACAAGTTCGCCGCCGCCATGATCAAGATGGGCAACATCGAGGTTAAGACCGGCACCACCGATGAGATCCGCCTCAACTGCAGCGTCGTCAACCCGTCGTCGTC
GTCGTCCACCGCTGGGGTGATCGAGATGCTGTTCCCTGCAGCCGACGAGGTTGCCACGAGCTCATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGACGAGAGGTGGCAGCGGATTCGCCGGCCTGCAGGTGGCGTGCGTCGTCGCCGCCCTGTGCCTGCTCCTGCCGACGGGGAGCCGCGCCCAACTGCAGGTGGGGTTCTACAACACC
TCCTGCCCCAACGCCGAGGCGCTCGTGCGTCAGGTCGTCACGGCTGCTTTCGCCAACAACTCCGGCGTCGCACCCGGGCTCATCCGCCTCCATTTCCATGACTGCTTCGTCAGG
GGTTGC
GATGCCTCCGTGCTCCTGTCCGTGAACCCCGCCGGCGGCAAAACGGAGCGTGAGTCCCCGGCCAACGACCCGAGCCTGCGCGGCTTCGACGTGATCGACGCCGCCAAGGCCGCCGTGGAG
CGGAGCTGCCCACGCACGGTGTCGTGCGCCGACGTCCTCGCGTTCGCGGCCCGCGACAGCGTCACCCTGACGGGCAACCTCTTCTACGACGTGCCAGCGGGGCGGCGGGACGGCCGCGTG
TCCAACGAGACGGAGGCCAACGACAACCTGCTGGGGCCGGACAGCACGGCGGAGATCCTCATCGACGGCTTCGGGAAGAAGAACCTGAGCATCGAGGACATGGTGGTCCTGTCCGGCTCC
CACACCATCGGCCGCTCCCACTGCTTCTCCTTCCTGTCCACCAACCGGCAGCGGCTGGCCAACGGGACCATAAGCCCAGCGTACCAGGCGCTGCTGGAGGCGCTGTGCCCGCCCAACCCG
GGCCAGTTCACCCCCAACACCACGGAGATCGACGTCAGCACGCCCACCGTGCTGGACAACAACTACTACAAGCTGCTGCCGCTCAACCTGGGCCTGCACTTCTCCGACGACCAGCTTATC
CGCAACGGCACTCTCGCGCCGTTCGCCAGCGCATTCGCCGCCAACGAGACGCTCTGGAAGGACAAGTTCGCCGCCGCCATGATCAAGATGGGCAACATCGAGGTTAAGACCGGCACCACC
GATGAGATCCGCCTCAACTGCAGCGTCGTCAACCCGTCGTCGTCGTCGTCCACCGCTGGGGTGATCGAGATGCTGTTCCCTGCAGCCGACGAGGTTGCCACGAGCTCATGA

Retrieve as FASTA