Entry information : CsaAPx-R (Cucsa.162470.1)
Entry ID 7461
Creation 2010-08-09 (Christophe Dunand)
Last sequence changes 2011-07-28 (Catherine Mathe)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CsaAPx-R (Cucsa.162470.1)
Name (synonym) CsaAPx-R (Cucsa.162470.1)
Class Ascorbate peroxidase related    [Orthogroup: APx-R001]
Taxonomy Eukaryota Viridiplantae Streptophyta Cucurbitaceae Cucumis
Organism Cucumis sativus    [TaxId: 3659 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsaAPx-R
start..stop
S start..stop
VvAPx-R 415 8e-147 1..317 1..329
CsAPx-R 400 7e-141 1..317 1..334
CclAPx-R 399 3e-140 12..317 12..334
GhAPx-R 396 4e-139 48..317 65..333
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2095148..2095294 147 N° 2 2094788..2094873 86 N° 3 2094497..2094633 137 N° 4 2094157..2094227 71
N° 5 2094034..2094076 43 N° 6 2093822..2093918 97 N° 7 2093251..2093334 84 N° 8 2092544..2092665 122
N° 9 2092158..2092224 67 N° 10 2091809..2091908 100  
complement(join(2091809..2091908,2092158..2092224,2092544..2092665,2093251..2093 334,2093822..2093918,2094034..2094076,2094157..2094227,2094497..2094633,2094788. .2094873,2095148..2095294))


exon

Literature and cross-references CsaAPx-R (Cucsa.162470.1)
DNA ref. Phytozome 12:   scaffold01144 (2095294..2091809)
Protein sequence: CsaAPx-R (Cucsa.162470.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   317
PWM (Da):   %s   34584.96  
PI (pH):   %s   8.08
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTSTFFNPAPSCNVAVISSSFLRFKFIPKFPTTIPSSSVSTVSFRAKTTKREFVFSAALPFLLILHESVEGFKAEAAEGRRLDKTEVERIREEVRKVVTKGRAPGLLRLVFHDAGTFETNDTGGMNGSIVHELDRPENKGLKKSVILQEAKSTLDLIRPVSWADVIVVAGAEAVSICGGPSIAVDLGRLDSEKPDPEGKLPEESLDAVGLKQSFSRKGFSTRELVALSGAHTIGGKGFGSPVVFDNAYFKILLEKPWSSGGMSSMIGLPSDRALADDDECLRWIKEYAKDQNVFFEDFHNAYIKLVNSGAKWRS

Retrieve as FASTA  
Remarks Complete sequence from genomic (9 introns). Incorrect prediction from Phytozome ( first 2 exons are missing). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTTCCACCTTCTTCAATCCTGCGCCGTCGTGCAACGTCGCCGTCATTTCTTCTTCCTTTCTCAGATTCAAGTTCATACCGAAATTTCCCACCACCATACCTTCATCGTCTGTTTCG
ACGGTCTCCTTTCGCGCCAAAACTACC
GTTAACTGTTCTCTCCCCGCCCCTGGCCATGCTTCTGGTAAAATATTAATTAACTGCTTTCCTCTTCCTTTGTGCAAAGCCTTGGTCAATTCC
GATGGGTTTTGCCTATTCAATTTTCGGAACTTTGTATTTGACTGCTATTGTCTATCCTGTGTATCTGTATTTGGTTTGTGGCTTCTGAAACCAAAATCTGTATTATGCATTTTGCAATGG
CGAACTGATCCTTTAAAGTACTGTTTGAATTACAGTTCAGACTGATTTCTGCTTTCTGAAGAAGAGGGAATTTGTCTTTTCTGCCGCGCTGCCCTTTCTTCTTATTTTGCATGAATCCGT
GGAAGGTTTTAAAGCTGAGGCGGCAGA
GTAAGATGGAGGATGAGGATATTGCTTACGATTAGTTTGAAGTATTTAATATAAAACTTTCTGTATTCTAGAATCTTGTTCATTATTGAAAAC
TCATGAATTCTTATGTCCTAGTAGAGGGATTATTAACTGAGTTCTGTCTGTTTTCTTTTAGGGGCAGAAGATTGGATAAAACGGAAGTTGAACGGATAAGAGAAGAAGTAAGAAAGGTGG
TAACCAAAGGAAGGGCTCCTGGTCTGCTTCGTTTGGTATTTCACGATGCTGGAACTTTTGAAACCAATGATACTTCAG
GTTAATATCCTTAAACTTTAAGAGGAGAGGCAATGAGGTTTT
CTTAGGCGTCCTGAATTATTTGAATTCATACATAGATTTTAAATTTTGAGTTCAATTGTTGGAATTCAGACAGCATTGGATATGTTGTATGAACTGTTATTTGCACCAAATGTGAAGTTT
TGTTCGATCACGGAGGCCATGATATCCACTTCCATGTAGGCTTTCAGACATGTTTGTTCTTGTATAGTTTTCAGTATGATTGTCATTTTAGTGAGCCTTGTTTGCAGGTGGTATGAACGG
ATCTATAGTTCATGAACTTGATAGACCTGAAAACAAAGGTCTCAAGAAATCAGTTAAG
GTGGTTCTTTCTTCTTATTCCCTTTTTGTTTTAGGAATCTGTCTACCAGCAAGCTCATCATT
GGTTTTGTTGTTTCTTAGATTCTTCAGGAAGCAAAGAGTACACTGGACTTAATTAGACCTGGTAAGTTTACTCTCTATTTCTCCATTTCTATCTGAAAGGAGATGAAGTTTCCATAATAA
GAGGTATTGACTAGTAGCCAGGCTAACTTCTTAGCAAATTGGTTTCTTTTGAATAGTATCGTGGGCAGACGTGATAGTAGTGGCTGGTGCTGAAGCAGTTTCAATATGTGGGGGTCCAAG
TATTGCTGTTGATTTGGGTAGATTAGACTCGGA
GTAAGCTGAAGCTGGCTGTTTTCCTTGTTATATGATGAACCATATTTTCCTTGAGTTGCAGCCTGTTAACGTTCTTTTTGCTTGTTT
TTCCATGAGCTTTATGTACCAGAATCATTTGTTTCTCTGGACTATGATAGTTACATTCTCACCATTTTAACTTTTCCCATGGGCTTTGTGCACAAGAGAAAGTTCCGAATTCTGAGATAT
CCTCTCTCTCACATTCATCACAATAGATAGATCCCTCTTCACTGTGTACACTCTCTTTTTCTCCCATACATCATTTCTACCTATGCTCTGCTGACTAGCTCTCTAACCGAGTTTTAGTCC
TCATGATAGTAGACCATTTTAGCTAATGAATTTCCTGTGTTCCCACTGCCGAACTCTTTATCTTTCTCATCAATTCCTCTGTCCGTCATATGATAGAAGGTTTGTCATATTAATTTTAGC
TGTTTTTCTTTTTCCAATTGTTTCTTTCCTTTCCAAATAGGAAGCCGGATCCAGAAGGTAAACTTCCTGAGGAATCTCTGGATGCTGTTGGATTGAAGCAAAGCTTCAGCAGAAAAGGAT
TTTC
GTGAGTGCATCTATCTCATTTTGACTCTTCCATTTGAAGGAGCTGTAGTCACTGGACTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTGGCCAATATATTCTAAGT
TACTGCATTGCTCTCCTTCATATATTTATTTACTAATGTGGCCGAATCTCTAAGATGTAATCTGGATTCGTTTCCTTACAGTAGACATAAAATGGCTAAAAAGTCTATTATTAGAACTTT
AGGAATGGGAAATCCTAGTTCTGCATTTGATTGTACAACATAGTCCTTTCAAATGTGTGTTGAACAGTGTTGTTTTTTATGAAAACCAACTCAACCCTCCCACTGTGAAGTATATTCGCA
TGGACAGTAGTAGAGAAGTTAAAATGCTCGTCACTCTAGAAATATGCCCATCCTCTGTCCTATCCTTTCTTCTTTCACATATTTTTTTACAAAGAAACAATTTCATTGGTATATGAAATT
GGAGAGTAGAACTCCAAATGAATGCCAGATAATTCATAATAGAATGAATTTACACCTCCAAGGTGTCTTCTGCATGATGACATTCACGGATACTCTTTTTTCTTTGCAGGACACGAGAAC
TAGTTGCACTATCTGGAGCCCATACTATTGGTGGGAAAGGTTTTGGAAGCCCTGTTGTTTTTGATAATGCATATTTCAAAATACTTTTGGAGAAGCCATGGTCATCTAACG
GTAATCAAT
CTCAGAATGATACTTTCACACGTCTCATTTTGTTTGAATTGAGCCTCAATTGCAAATCATTGGCTGCCTGAGGCACTCCCTCAATTTTTGCTCAAATCCACATTATTAGTGTTCCCGTGA
ATCAGTGGGTAACGAAAAATGAAAGCTAGTTTTTTGTTTTTCTAGTTGAAGTGAGCTATGAAGTTCTTGTGATTACTCAAACTGAGTTGTTACTTTTGTGGCTTTTGCCATTGATTAATA
ATACAAGTCATTGCTTTGAATTGGTTTATACATATTTCCACTCGAGCCNNNNNNNNNNNNNNNNNNNNNGGTGGTATGTCAAGTATGATAGGGCTACCTTCTGATCGAGCTCTTGCTGAC
GATGATGAATGCTTGAG
GTTCTTCTCTTTCATTCAAATCTATACTATTGTCATCATTACTTTTCTGCACCACTGTGAACTGATGCCATTTCTGGTCTCTTGAGTAGAATTTCAGCAATGA
GTTCAATTTGTTGAACTAAAGTAGAAATGTTCATAAAAGATCAATTTTACAACCAGACAACCAGCAAGATTTACCTGATAAACAGAAAATGAGCTGATTACCCCTCTTTATCTGCTTAAA
TAAAGTGAATTACTTTGAACTCCTAGATGGATCAAAGAGTATGCCAAGGATCAGAATGTGTTCTTCGAAGATTTCCATAATGCTTATATCAAGCTAGTAAATTCTGGTGCAAAGTGGAGA
AGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTTCCACCTTCTTCAATCCTGCGCCGTCGTGCAACGTCGCCGTCATTTCTTCTTCCTTTCTCAGATTCAAGTTCATACCGAAATTTCCCACCACCATACCTTCATCGTCTGTTTCG
ACGGTCTCCTTTCGCGCCAAAACTACC
AAGAGGGAATTTGTCTTTTCTGCCGCGCTGCCCTTTCTTCTTATTTTGCATGAATCCGTGGAAGGTTTTAAAGCTGAGGCGGCAGAGGGCAGA
AGATTGGATAAAACGGAAGTTGAACGGATAAGAGAAGAAGTAAGAAAGGTGGTAACCAAAGGAAGGGCTCCTGGTCTGCTTCGTTTGGTATTTCACGATGCTGGAACTTTTGAAACCAAT
GATACTTCAG
GTGGTATGAACGGATCTATAGTTCATGAACTTGATAGACCTGAAAACAAAGGTCTCAAGAAATCAGTTAAGATTCTTCAGGAAGCAAAGAGTACACTGGACTTAATTAGA
CCTG
TATCGTGGGCAGACGTGATAGTAGTGGCTGGTGCTGAAGCAGTTTCAATATGTGGGGGTCCAAGTATTGCTGTTGATTTGGGTAGATTAGACTCGGAGAAGCCGGATCCAGAAGGT
AAACTTCCTGAGGAATCTCTGGATGCTGTTGGATTGAAGCAAAGCTTCAGCAGAAAAGGATTTTC
GACACGAGAACTAGTTGCACTATCTGGAGCCCATACTATTGGTGGGAAAGGTTTT
GGAAGCCCTGTTGTTTTTGATAATGCATATTTCAAAATACTTTTGGAGAAGCCATGGTCATCTAACG
GTGGTATGTCAAGTATGATAGGGCTACCTTCTGATCGAGCTCTTGCTGACGAT
GATGAATGCTTGAG
ATGGATCAAAGAGTATGCCAAGGATCAGAATGTGTTCTTCGAAGATTTCCATAATGCTTATATCAAGCTAGTAAATTCTGGTGCAAAGTGGAGAAGCTAG

Retrieve as FASTA