Entry information : AlyAPx-R
Entry ID 7462
Creation 2010-08-09 (Christophe Dunand)
Last sequence changes 2010-08-09 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyAPx-R
Name AlyAPx-R
Class Ascorbate peroxidase related    [Orthogroup: APx-R001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyAPx-R
start..stop
S start..stop
AhalAPx-R01 653 0 1..329 1..329
AtAPx-R 649 0 1..329 1..329
BstrAPx-R01 596 0 1..329 1..331
CrubAPx-R01 579 0 2..329 3..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3907929..3908112 184 N° 2 3907710..3907812 103 N° 3 3907474..3907589 116 N° 4 3906913..3906983 71
N° 5 3906703..3906745 43 N° 6 3906537..3906633 97 N° 7 3906360..3906443 84 N° 8 3906149..3906270 122
N° 9 3905932..3905998 67 N° 10 3905631..3905733 103  
complement(join(3905631..3905733,3905932..3905998,3906149..3906270,3906360..3906 443,3906537..3906633,3906703..3906745,3906913..3906983,3907474..3907589,3907710. .3907812,3907929..3908112))


exon

Literature and cross-references AlyAPx-R
DNA ref. Phytozome 11:   scaffold_7 (3908112..3905631)
Protein sequence: AlyAPx-R
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329
PWM (Da):   %s   35888.56  
PI (pH):   %s   9.02
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTTTTASLLKTCLFGCDSSSSFKFKCKFESPAKTRLLSPATGKHVVRSLRAWRIRCISDDPGSSHVFVSSRRKMVVLLSTVQLLSHLLPQNGNAAEIYPVMQNEIRKVVTKGKAAGVLRLVFHDAGTFELDDHGGINGSIAYELERPENTGLKKPLVLAKAKIKVDEIQPVSWADMISVAGSEAVSICGGPTIPVVLGRLDSAQPDPEGKLPPETLSASGLKECFKRKGFSTQELVALSGAHTIGSKGFGDPTVFDNAYYKILLQKPWTSSKMTSMVGLPSDHALVEDDECLRWVKRYAEDQDKFFEDFNNAYIKLVNSGAKWNKL

Retrieve as FASTA  
Remarks Complete sequence from genomic (9 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGACGACGACTGCTTCTCTTTTGAAGACTTGTCTTTTTGGGTGCGACTCGTCTTCTTCTTTCAAATTCAAATGCAAATTCGAATCTCCCGCGAAAACGCGATTGCTCTCTCCGGCG
ACCGGGAAACATGTTGTCAGATCGTTAAGAGCCTGGCGTATTCGTTGTATCTCCGATGATCCTG
GTAAGACCGGATTCTAGTATCATCGTCAATTCTACTCTATCGCTTTTCGTTTCCGT
CGATTTTCCCTGGTTTATTGAATTCGTGCTGAGATTGTTCTGTTTCTTTATAATTTATAGGTTCGAGTCATGTTTTCGTTTCCAGTAGAAGAAAAATGGTAGTCTTGTTGTCGACGGTGC
AACTTCTGTCTCATTTGCTTCCGCAAAACGGGAACGCAGCTGA
GTGAGTTTTAAACAATCCTTAATTTTGTGTAATTCACTCTGAAATTTGGTAAATTGTTCAAGTTATAGTTTTCCCAA
ATTTTTGTGTGCTAGTTATCCAAATTCATTGTTGGATTTTCAGGATTTATCCGGTGATGCAAAACGAAATAAGGAAAGTGGTGACAAAGGGTAAGGCTGCTGGTGTGCTTCGTTTAGTGT
TTCATGATGCTGGAACCTTTGAACTGGACGATCATTCTG
GTAAATTTCCATGACTCTATGTAATGATCAGAATTTTGCTTCAACTTTAGTATTCGACTCTTTTGTCAAGTTGCTATCTAT
TTCTACAAGTTGGATTGTTTCTTTCATTGTAAACTCATCATAGGTGAACATGGATATTAACTTTGAAAGTTCATTTATCAGTTGACTTGGTGATAGACAAGTTTGCTTATGTAAACATTG
TTTGTTAGATTATATTTAGAATGTGATTTCTGGATGTTTTGGGTAGCTTGTGAGTGTTTCTTGGCTTAGTTTAACAGACTGTCAAGTAGTCTGATCAGTGGCTCTCTCAGGATGTGCTTA
TCATTTTACAAGTTGATATACCTCAGTTTTGGCTTTGATGAACCAAGCTTGGGTGGTTTAGATTCAGGTCTTTGCGATTTAGTATACTTCTGCTGGTGTTTTCCTTCGTTCTCATTAAAA
GATGCTACAACTATGTCTTAGTTCTTCTTGGTTATGACTTTAATTGCAGGTGGCATCAACGGGTCTATTGCTTATGAACTCGAGAGACCTGAAAACACAGGTTTGAAGAAACCCTTAAAG
GTACTAAATCCATCTCTTTTATTTCTGTTAGCATGAGCAAATAGAGATGTACTTTTCTCGTCTGTTTAACTGCTTTTTTTTTTGTGTCTATTTGCACTTGTTTCTCGGATTTGTCAACTA
TGTTACTTTCAAAGAACTAATCTTCTTGTAGATGAATTCTTTGTTAGGTTCTAGCGAAAGCAAAGATTAAGGTTGATGAGATACAACCAGGTAATTGTTATTTGAAACGTGTTCTGTTAT
GTGCCTTGGTGCCAGTGTTCTCATTCTATGTGATCTCAGTGTCTTGGGCGGATATGATCTCTGTCGCTGGATCTGAAGCAGTTTCAATATGTGGCGGCCCAACAATTCCAGTAGTTTTGG
GGAGACTTGATTCAGC
GTAAGCACAACATAAACGGTTTTAGTCCTGATTCGATAGATCTCTGGTCACTGTTTCTATACTTCCAACAGGATGATTGTTTCATGTTTACAGGCAACCTGATC
CAGAAGGCAAGCTACCTCCAGAAACCCTGAGTGCCTCGGGCTTGAAAGAATGCTTCAAAAGAAAAGGATTTTC
GTGAGTCCTTAGCTGAGAATTGTTTCAACATGTTTTTATTATATCAA
CATTTTGTAATTTGACATCACTGGGTTTATGTGCCAATGCAGGACCCAGGAGCTTGTTGCCTTATCTGGGGCACATACGATTGGGAGTAAAGGCTTTGGAGATCCGACAGTGTTTGATAA
TGCATACTACAAAATCCTTCTTCAAAAACCATGGACATCAACTT
GTAAGTCTCATGACATGATTCTCATGTTCTTTTACGCATACAGTTTCAGTTTCTAACCATTGCTCCCAATGTTTTA
GCATCTAGCACGTTCTGAAGATTGACTGTAAGACTGAGATTATATATTTGCATAATTTTCTTCTTATGATGCAGCCAAAATGACCAGCATGGTCGGGCTTCCTTCGGATCATGCCTTAGT
GGAGGATGATGAGTGCTTAAG
GTTTCAGAAAGTTCTTACCTTATCATTTCATATGTAATTTTCTCTTAATTACCAGTTAAAGTAGAGTAGAGTAATGTGCTGAACACTTGGACTATAGGC
TCATGGATAAAAGTGGAAACTGTTGAACACTAATCTTGTCGTTTGAGCGATCTGGAAAACTATACAACTGATATAGATGTGTGGGTTGATGATTCACAGGTGGGTGAAACGATATGCAGA
AGACCAAGACAAGTTCTTCGAAGACTTCAACAATGCTTATATCAAACTAGTTAATTCAGGGGCCAAATGGAATAAGTTATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGACGACGACTGCTTCTCTTTTGAAGACTTGTCTTTTTGGGTGCGACTCGTCTTCTTCTTTCAAATTCAAATGCAAATTCGAATCTCCCGCGAAAACGCGATTGCTCTCTCCGGCG
ACCGGGAAACATGTTGTCAGATCGTTAAGAGCCTGGCGTATTCGTTGTATCTCCGATGATCCTG
GTTCGAGTCATGTTTTCGTTTCCAGTAGAAGAAAAATGGTAGTCTTGTTGTCGACG
GTGCAACTTCTGTCTCATTTGCTTCCGCAAAACGGGAACGCAGCTGA
GATTTATCCGGTGATGCAAAACGAAATAAGGAAAGTGGTGACAAAGGGTAAGGCTGCTGGTGTGCTTCGTTTA
GTGTTTCATGATGCTGGAACCTTTGAACTGGACGATCATTCTG
GTGGCATCAACGGGTCTATTGCTTATGAACTCGAGAGACCTGAAAACACAGGTTTGAAGAAACCCTTAAAGGTTCTA
GCGAAAGCAAAGATTAAGGTTGATGAGATACAACCAG
TGTCTTGGGCGGATATGATCTCTGTCGCTGGATCTGAAGCAGTTTCAATATGTGGCGGCCCAACAATTCCAGTAGTTTTGGGG
AGACTTGATTCAGC
GCAACCTGATCCAGAAGGCAAGCTACCTCCAGAAACCCTGAGTGCCTCGGGCTTGAAAGAATGCTTCAAAAGAAAAGGATTTTCGACCCAGGAGCTTGTTGCCTTA
TCTGGGGCACATACGATTGGGAGTAAAGGCTTTGGAGATCCGACAGTGTTTGATAATGCATACTACAAAATCCTTCTTCAAAAACCATGGACATCAACTT
CCAAAATGACCAGCATGGTC
GGGCTTCCTTCGGATCATGCCTTAGTGGAGGATGATGAGTGCTTAAG
GTGGGTGAAACGATATGCAGAAGACCAAGACAAGTTCTTCGAAGACTTCAACAATGCTTATATCAAACTAGTT
AATTCAGGGGCCAAATGGAATAAGTTATGA

Retrieve as FASTA