Entry information : AlyDiOx02
Entry ID 7463
Creation 2010-08-10 (Christophe Dunand)
Last sequence changes 2010-08-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyDiOx02
Name AlyDiOx02
Class Alpha-dioxygenase    [Orthogroup: DiOx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyDiOx02
start..stop
S start..stop
AtDiOx02 1278 0 1..631 1..631
ThasDiOx02 1112 0 1..631 1..632
CclDiOx01 1037 0 1..631 1..633
CsDiOx01 1035 0 1..631 1..633
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 15950191..15950283 93 N° 2 15949763..15950023 261 N° 3 15949075..15949224 150 N° 4 15948841..15948971 131
N° 5 15948537..15948750 214 N° 6 15948026..15948399 374 N° 7 15947741..15947943 203 N° 8 15947413..15947656 244
N° 9 15947095..15947320 226  
complement(join(15947095..15947320,15947413..15947656,15947741..15947943,1594802 6..15948399,15948537..15948750,15948841..15948971,15949075..15949224,15949763..1 5950023,15950191..15950283))


exon

Literature and cross-references AlyDiOx02
DNA ref. Phytozome 12:   scaffold_2 (15950283..15947095)
Protein sequence: AlyDiOx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   631
PWM (Da):   %s   72052.47  
PI (pH):   %s   6.62
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGFSPSSSWFLHPQLHHVVSEMSYFDAFIFYIVHLVDKLGLWHRFPVLLGVAYLGLRRHLHQRYNLVHVGPINGQGYDNDEFCYRTADGKCNHPSDDSIGSQGSFIGRNMPPSTSQYGILDPHPSVVATKLLARKRFIDNGDQFNVIACSWIQFMIHDWVDHLEDTHQIELEAPEEVASGCPLKSFKFLRTKKVPTGDHHKSGAVNTRTPWWDGSVIYGNDEAGMRRVRVFKDGKLKISGDGLLERDERGVPISGDIRNSWSGFSLLQALFVKEHNSICDMLERYPDFDDEKLYRTARLVTAAVIAKVHTIDWTIELLKTDTLTAGMRINWYGFLGKKVKDMVGARFGPIFSGLVGLKKPKDHGVPYSLTEEFVSVYRMHCLLPETLILRDMKSENVDKANPAIEREIPMTELIGKEAGLKGSKIGFEQLLVSMGHQSCGALTLWNYPNWMRNLVAQDIDGEDRPHLIDMAALIYRDRERGVPRYNEFRKNLLMSPISKWEELTDDEEAIKVLREVYEDDIEKLDLNVGLHAEKKIKGFAISETAFFIFLLVASRRLEADRFFTTNFNEKTYTKEGLEWVNTTETLKDVIDRHFPSLTDQWMRCSSAFSVWGSDPNPNTWVPLYLRSAP

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 8 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTCTCTCCATCTTCTTCATGGTTTCTTCATCCTCAGCTTCATCATGTTGTTTCCGAGATGTCTTACTTTGATGCTTTTATATTCTATGTAAATATATACATCTCTCTCTTTGAC
AAAAAAATAAATACATCTCTCTCTATCTCTCTAAAATATATATGAACTCTTCTCTTAAGAAAATATTAATCATATAATTTTTGTAAACTTTTTATTATTATTTGGTTAATTTGATTGTTT
TTCAATTTTTATATTTATAGATTGTGCACTTAGTGGACAAGCTAGGATTGTGGCATAGATTTCCAGTGTTATTAGGAGTGGCTTACTTGGGGTTACGAAGACATCTACATCAACGTTACA
ATCTGGTACATGTCGGTCCGATCAACGGTCAGGGTTACGACAACGATGAGTTCTGTTATCGGACGGCTGACGGCAAGTGTAATCATCCCTCCGACGACTCCATCGGCAGTCAAGGCAGCT
TCATCGGCCGGAATATGCCTCCCTCTACTTCTCAGTACGGC
GTAAGTTTTTTCTTGGTCTCCTTCATATTCACAATTACTATTTCATAACATGCAAATTAAATTTGCAAACTTAGATTTG
TACTTTTGATTAAATTTTAATATAAAGCGAAGTGATAATATAGCAAAAATAAATAGTAGCGGAATGAAACACTAGAACCAAATTTTGTGACGTATTTCTTTTTAATCTCTACTAACCGGT
GGTTGAAAGCATGATGTAATTCTCTTCTGTGTTTATTTTATTTTGTCGATTTTTGATTGATTTTAAGTGTACATTGATTTTTTTTGTCAAAGTTTTTTTGTCAATACTTATTTCACTGAA
AATTTTAGAAAAAAACTTAAAAAATTGTTGGAGCTTTAGTATTATTGGGGCGGAGGCGGACATACCTCATGAGAGCCACCATAATTGTATTTCTGTTGTTTTTGCATGATTAGTAATACA
TCTACGGAATTATGTTATGAATTACATTAGTATGATGAGTAAATGCACAACGGCTTGATACATATATTTTATATAATATAATATTGTGTATCATGACAGATTTTGGATCCACATCCAAGT
GTAGTGGCGACAAAGTTGTTAGCGAGAAAAAGATTCATAGACAATGGGGACCAATTCAACGTGATAGCTTGTTCTTGGATCCAGTTCATGATCCATGATTGGGTTGATCACTTAGAAGAC
ACCCACCAG
GTTTATAATATTTTCAAATTTAACCCCTTTAATCTCAAAGATTTACATTTCTTTCCCTCAACTTTAGATTATAGAACAATAAAGATATTGAAACCTCAACCAGATTGAGCT
TGAAGCTCCAGAAGAAGTAGCAAGTGGATGTCCATTGAAGTCATTCAAGTTCCTCAGAACGAAGAAAGTTCCCACCGGTGATCACCACAAATCTGGCGCTGTCAACACTAGAACCCCTTG
GTG
GTTAGTATCTCAATCATTAGTCACTGCTTAATTGTTGTTTAATTACTATATATCCGAGTTCGATTTTACAAAACATTATATTGGGGATAGGGATGGGAGTGTAATATATGGGAATGA
CGAAGCCGGAATGAGAAGAGTTAGGGTTTTCAAGGACGGAAAGCTAAAAATCTCTGGGGATGGCTTGTTGGAGAGGGACGAAAGAGGTGTTCCTATCTCCGGTGACATAAGAAACAGCTG
GTCAGGTTTCTCTCTGTTGCAAGCTCTCTTTGTGAAAGAACATAACTCTATCTGTGATATGCTCAAA
GTAAGTCATTAAATTGATCCTATAACTACGTTTTGCCTCTTTCTTGTGCTGCA
AGCAGCAACTCTGTCTTTTTTCTTCTTCTTCTTTTTAGCAACTCTGTTTATGCACAATCATATTAAGTTTTAACATTTTTTCAGGAACGGTATCCAGATTTTGATGATGAGAAACTCTAC
CGGACTGCTAGACTGGTGACTGCAGCGGTTATCGCTAAGGTTCATACAATCGATTGGACAATAGAACTCTTGAAAACAGACACACTCACTGCTGGAATGAGGATCAACTGGTATGGGTTT
TTAGGGAAGAAAGTGAAGGACATGGTCGGAGCAAGATTTGGTCCTATATTTAGCGGCTTAGTTGGTCTGAAGAAACCGAAAGATCATGGAGTTCCTTATTCCCTTACCGAAGAGTTCGTT
AGTGTTTACAGGATGCATTGTCTTCTACCAGAGACACTTATCCTCCGAGATATGAAATCTGAGAATGTTGACAAAGCAAACCCTGCAATAGAACGAGA
GTAAGATATAGGATGTTTGGTA
CATTTTTTTAGGTCAATCCAAGCACGGTTTTTCTTGACCTATAAAGTTTTTTTTTTACAGGATACCGATGACGGAACTGATTGGGAAAGAAGCAGGACTAAAGGGTTCGAAAATTGGGTT
TGAGCAATTACTTGTTTCAATGGGACACCAATCTTGTGGGGCATTGACATTGTGGAATTACCCTAATTGGATGAGGAACCTTGTGGCTCAAGATATCGACGGAGAAGATAGACCTCACCT
TATAGATATGGCTGCCTTGGAGA
GTAAGTCAAAATTAATTCTTCTTCTTCTTCTATACATCAGCAATGCTCAACCGATTGATTGATCTGATTTGATTTTGTTCTCAGTTTATAGAGATCG
GGAGAGAGGAGTTCCTCGGTACAACGAATTCAGAAAGAATCTGTTGATGAGTCCGATCAGCAAATGGGAAGAGTTGACAGATGATGAAGAAGCTATCAAGGTTTTAAGAGAAGTGTACGA
AGACGATATAGAGAAGCTTGACCTTAACGTGGGACTGCACGCAGAGAAGAAGATCAAAGGATTCGCCATCAGCGAAACAGCTTTCTTCATCTTTCTCCTCGTCGCCTCCAG
GTTTTTAAA
TTCCTCAATAATACTACATTTTGTTAAAACAGAGTATTTTCTTGTGTAACAAGGAAACTTACTTGGACTTCAATTTTTTTAAGGAGGCTAGAAGCAGATAGGTTTTTCACGACGAACTTC
AACGAGAAGACGTATACTAAAGAAGGATTAGAGTGGGTCAATACTACAGAGACTTTAAAAGATGTAATAGACAGACACTTCCCAAGCTTAACCGATCAATGGATGCGATGTTCTAGCGCC
TTCTCTGTCTGGGGCTCGGATCCTAACCCAAACACTTGGGTTCCTTTGTACCTCCGATCCGCTCCATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTCTCTCCATCTTCTTCATGGTTTCTTCATCCTCAGCTTCATCATGTTGTTTCCGAGATGTCTTACTTTGATGCTTTTATATTCTATATTGTGCACTTAGTGGACAAGCTAGGA
TTGTGGCATAGATTTCCAGTGTTATTAGGAGTGGCTTACTTGGGGTTACGAAGACATCTACATCAACGTTACAATCTGGTACATGTCGGTCCGATCAACGGTCAGGGTTACGACAACGAT
GAGTTCTGTTATCGGACGGCTGACGGCAAGTGTAATCATCCCTCCGACGACTCCATCGGCAGTCAAGGCAGCTTCATCGGCCGGAATATGCCTCCCTCTACTTCTCAGTACGGC
ATTTTG
GATCCACATCCAAGTGTAGTGGCGACAAAGTTGTTAGCGAGAAAAAGATTCATAGACAATGGGGACCAATTCAACGTGATAGCTTGTTCTTGGATCCAGTTCATGATCCATGATTGGGTT
GATCACTTAGAAGACACCCACCAG
ATTGAGCTTGAAGCTCCAGAAGAAGTAGCAAGTGGATGTCCATTGAAGTCATTCAAGTTCCTCAGAACGAAGAAAGTTCCCACCGGTGATCACCAC
AAATCTGGCGCTGTCAACACTAGAACCCCTTGGTG
GGATGGGAGTGTAATATATGGGAATGACGAAGCCGGAATGAGAAGAGTTAGGGTTTTCAAGGACGGAAAGCTAAAAATCTCTGGG
GATGGCTTGTTGGAGAGGGACGAAAGAGGTGTTCCTATCTCCGGTGACATAAGAAACAGCTGGTCAGGTTTCTCTCTGTTGCAAGCTCTCTTTGTGAAAGAACATAACTCTATCTGTGAT
ATGCTCAAA
GAACGGTATCCAGATTTTGATGATGAGAAACTCTACCGGACTGCTAGACTGGTGACTGCAGCGGTTATCGCTAAGGTTCATACAATCGATTGGACAATAGAACTCTTGAAA
ACAGACACACTCACTGCTGGAATGAGGATCAACTGGTATGGGTTTTTAGGGAAGAAAGTGAAGGACATGGTCGGAGCAAGATTTGGTCCTATATTTAGCGGCTTAGTTGGTCTGAAGAAA
CCGAAAGATCATGGAGTTCCTTATTCCCTTACCGAAGAGTTCGTTAGTGTTTACAGGATGCATTGTCTTCTACCAGAGACACTTATCCTCCGAGATATGAAATCTGAGAATGTTGACAAA
GCAAACCCTGCAATAGAACGAGA
GATACCGATGACGGAACTGATTGGGAAAGAAGCAGGACTAAAGGGTTCGAAAATTGGGTTTGAGCAATTACTTGTTTCAATGGGACACCAATCTTGT
GGGGCATTGACATTGTGGAATTACCCTAATTGGATGAGGAACCTTGTGGCTCAAGATATCGACGGAGAAGATAGACCTCACCTTATAGATATGGCTGCCTTGGAGA
TTTATAGAGATCGG
GAGAGAGGAGTTCCTCGGTACAACGAATTCAGAAAGAATCTGTTGATGAGTCCGATCAGCAAATGGGAAGAGTTGACAGATGATGAAGAAGCTATCAAGGTTTTAAGAGAAGTGTACGAA
GACGATATAGAGAAGCTTGACCTTAACGTGGGACTGCACGCAGAGAAGAAGATCAAAGGATTCGCCATCAGCGAAACAGCTTTCTTCATCTTTCTCCTCGTCGCCTCCAG
GAGGCTAGAA
GCAGATAGGTTTTTCACGACGAACTTCAACGAGAAGACGTATACTAAAGAAGGATTAGAGTGGGTCAATACTACAGAGACTTTAAAAGATGTAATAGACAGACACTTCCCAAGCTTAACC
GATCAATGGATGCGATGTTCTAGCGCCTTCTCTGTCTGGGGCTCGGATCCTAACCCAAACACTTGGGTTCCTTTGTACCTCCGATCCGCTCCATAG

Retrieve as FASTA