Entry information : AlyPrxII06 (AlyPrxIIF)
Entry ID 7475
Creation 2010-08-10 (Christophe Dunand)
Last sequence changes 2010-08-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyPrxII06 (AlyPrxIIF)
Name (synonym) AlyPrxII06 (AlyPrxIIF)
Class Atypical 2-Cysteine peroxiredoxin (type II)    [Orthogroup: PrxII002]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrxII06
start..stop
S start..stop
AtPrxII06 405 4e-147 1..201 1..201
ThasPrxII03 363 3e-130 1..201 1..201
CclPrxII05 319 1e-112 1..201 24..224
LuPrxII119 318 9e-112 1..201 55..255
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2410246..2410461 216 N° 2 2410130..2410159 30 N° 3 2409878..2410036 159 N° 4 2409341..2409435 95
N° 5 2409145..2409250 106  
complement(join(2409145..2409250,2409341..2409435,2409878..2410036,2410130..2410 159,2410246..2410461))


exon

Literature and cross-references AlyPrxII06 (AlyPrxIIF)
DNA ref. Phytozome 11:   scaffold_3 (2410461..2409145)
Protein sequence: AlyPrxII06 (AlyPrxIIF)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   201
PWM (Da):   %s   21321.03  
PI (pH):   %s   9.35
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAMSILKLRNLSALRSAANSARIGVSSRGFSKLAEGTDITSAAPGVSLQKARSWDEGVSSKFSTTPLSDIFKGKKVVIFGLPGAYTGVCSQQHVPSYKSHIDKFKAKGIDSVVCVSVNDPYAINGWAEKLGAKDAIEFYGDFDGKFHKSLGLDKDLSAALLGPRSERWSAYVEDGKVKAVNVEEAPSDFKVTGAEVILGQI

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, 4 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGATGTCAATTCTAAAGCTAAGAAATTTATCGGCTTTAAGATCGGCCGCAAATAGTGCCCGGATCGGAGTTTCCTCGAGGGGTTTCTCAAAGCTTGCGGAGGGCACTGACATAACC
TCGGCGGCTCCCGGCGTCTCTCTCCAGAAAGCTCGGAGCTGGGACGAAGGCGTTTCCTCCAAATTCTCCACCACACCATTGTCAGATATCTTCAAG
GTTCGATTCTCTCTTTTCGGACAA
TTTCAATTCAGAGGGGAATTTCAATTTCTGACAAAACGTTTGTGGATATTGATTGGTTACAGGGGAAGAAAGTCGTCATTTTTGGACTCCCTGTAAGAAAATTTCTATCCTTTCATCTTC
CTCTATGTCTTGATCATGTTTCTGAGTTCTGATGTTGTGCCGGAATATCTGTTTTCTGTGTGCAGGGGGCTTACACGGGAGTTTGTTCGCAGCAGCATGTGCCTAGCTACAAGAGCCACA
TTGATAAGTTTAAGGCTAAAGGCATTGATTCTGTCGTATGTGTCTCTGTTAATGATCCCTATGCTATCAATGGTTGGGCTGAGAAGCTTGGTGCCAAAGATGCA
GTAAGTTCATCCATGT
TTAGTGTCTGCTGGTTTGGTTATTTGCTTCAGAAAACTTGATTTTGAAACATGATATTATATTATCCGGTTCCTGGTTTTGTTGTCTAAGAGTTTTTGAGTGGTGAAGATGGATCATTTA
GGAATCTTTTAACTCCTTTTGGTATGTAGCTCTTGTTGACGTCCTGATAGTAATCTACCTCTTATAGTTAGGACTATTACTCTATTATTTCACATCATCTATGGTCTCAAGCTTACATTC
ACATCAATAGACGATAAAAAAGATTTGATACTATGATTAACTTGACAACCCTTGTTATTTTATTAGAAAATTCATAATTCTTGATATGGACTAGCATTACAATATATTTCTATGTTTATG
TTCGGATAGTGTTACATGCTAGAACTAATGACTTAATGTGATGCTCTTAAACTTTTGTCATACCAGATTGAGTTTTATGGGGATTTTGATGGGAAATTCCACAAAAGCTTGGGGCTAGAC
AAGGATCTCTCTGCTGCATTACTCGGGCCACGGTCTGAGAG
GTAATACACTGCAAAGTCCATTTGTAGAAATGTTTGTATCGTGAACCATTGATCTAACAGATTCGTTGGAATTATGATG
TCCATGTTCAGATGGTCGGCTTATGTAGAAGACGGTAAGGTTAAGGCGGTGAATGTGGAAGAAGCACCGTCTGACTTCAAGGTTACAGGGGCAGAAGTCATCTTAGGACAGATCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGATGTCAATTCTAAAGCTAAGAAATTTATCGGCTTTAAGATCGGCCGCAAATAGTGCCCGGATCGGAGTTTCCTCGAGGGGTTTCTCAAAGCTTGCGGAGGGCACTGACATAACC
TCGGCGGCTCCCGGCGTCTCTCTCCAGAAAGCTCGGAGCTGGGACGAAGGCGTTTCCTCCAAATTCTCCACCACACCATTGTCAGATATCTTCAAG
GGGAAGAAAGTCGTCATTTTTGGA
CTCCCT
GGGGCTTACACGGGAGTTTGTTCGCAGCAGCATGTGCCTAGCTACAAGAGCCACATTGATAAGTTTAAGGCTAAAGGCATTGATTCTGTCGTATGTGTCTCTGTTAATGATCCC
TATGCTATCAATGGTTGGGCTGAGAAGCTTGGTGCCAAAGATGCA
ATTGAGTTTTATGGGGATTTTGATGGGAAATTCCACAAAAGCTTGGGGCTAGACAAGGATCTCTCTGCTGCATTA
CTCGGGCCACGGTCTGAGAG
ATGGTCGGCTTATGTAGAAGACGGTAAGGTTAAGGCGGTGAATGTGGAAGAAGCACCGTCTGACTTCAAGGTTACAGGGGCAGAAGTCATCTTAGGACAG
ATCTAA

Retrieve as FASTA