Entry information : AlyPrxIIA-2
Entry ID 7476
Creation 2010-08-10 (Christophe Dunand)
Last sequence changes 2010-08-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-05-10 (Christophe Dunand)
Peroxidase information: AlyPrxIIA-2
Name AlyPrxIIA-2
Class Atypical 2-Cysteine peroxiredoxin (type II)    [Orthogroup: PrxII002]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrxIIA-2
start..stop
S start..stop
AtPrxII01 796 0 1..535 1..549
AlyPrxIIA-1 620 0 148..530 9..386
AlyPrxIIA-4 603 0 148..535 11..396
AlyPrxIIA-3 561 0 147..534 10..389
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10581303..10581457 155 N° 2 10581098..10581177 80 N° 3 10580778..10580984 207 N° 4 10579553..10580718 1166
complement(join(10579553..10580718,10580778..10580984,10581098..10581177,1058130 3..10581457))


exon

Literature and cross-references AlyPrxIIA-2
DNA ref. Phytozome 11:   scaffold_2 (10581457..10579553)
Protein sequence: AlyPrxIIA-2
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   535
PWM (Da):   %s   60729.96  
PI (pH):   %s   7.85
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPIAVGDVVPDGTISFVDDNDQLQTASVHSLAAGKKVILFGVPGAFTPTCSMKHVPGFIEKAEELKSNYVDEIICFVNDPFVMKAWGKTYAENKHVKFVADGSGKYTHLLGLELDLKDKGHGVRSKSFALLIDNLKVIVAKVESGDLVERIVSMVPLKFMRSVRLTCKRWNGLFKSRSFMKMHIDKEAAARELGETRMIVMMDYNVYLMGIVVNENTSTESLGKLTCLDDSEQVKISQVFHCDGLLLCILKDDDTKIVVWNPYLGQTRWIQTRKYYRAGGWKGRDIYMYALGFKNNSKSRSCRSPKILRFIDDFKLRPENPALRYEIYDFDSDLWTTLDVSPHWRIMSQRGLSIKGNTYWGAVERNEYAPISHIICFDFTRERFGPLLPLPFSAWGAEFASLSSVREEKIAALFQTSETFKFEIWITTKIEAENVSWSRFFTMDTSYLDSKLSYKSFFIDEEKKVAVVFEKEGKTICDLTHDTINIIGEDGCIMKLELGEPADKNCWPLVCSYVPSVVQIKLHKGGKRKEQSD

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCCAATTGCTGTCGGCGATGTTGTACCTGACGGAACCATCTCTTTCGTCGATGACAATGATCAACTTCAGACCGCCTCCGTTCACTCTCTCGCCGCCGGTAAGAAAGTCATTCTC
TTTGGTGTCCCTGGTGCTTTCACTCCCACATGCAG
GTACAAAGTTTCAAACTTTTTCAGATTTATCGTTTGAATTAGTTTTATAAGATGTGGGTTTTGATTCTAAGCTGATAAATCTCTA
GATTTGATTTGAGAATTGTGTTTTCTTCTTGTGAGGTTAGCATGAAGCATGTGCCTGGTTTCATTGAGAAAGCAGAGGAACTAAAATCAAATTATGTTGATGAGATCATTTGCTTTAGTG
GTAAGTATGAATTGATATGTTTTTTTATCTCTGTGATGAGTTTGTGTATACTTCTGAAATTGATCAAAACGTTTAATTGTATTGACGCCATCGTTTATATTGTATGGTTGCAGTGAATGA
CCCATTTGTGATGAAGGCATGGGGAAAGACATACGCTGAGAACAAGCATGTGAAGTTTGTAGCAGATGGGTCTGGAAAATACACACATCTTCTCGGACTTGAGCTTGACCTCAAAGATAA
GGGTCATGGTGTTAGGTCAAAGAGTTTCGCTCTGTTAATCGATAACCTCAAGGTGATTGTAGCCAAAGTTGAATCTGGAG
GTGAATGTCCCTTGTTTCAACTTGAAACGATGAAGATGAC
GATGTCTATCTTCCTATAGATTTGGTAGAGCGGATTGTCTCTATGGTTCCCTTGAAATTTATGAGATCAGTGCGATTAACTTGCAAAAGGTGGAACGGTTTGTTCAAAAGCCGGAGCTTT
ATGAAGATGCACATTGACAAAGAAGCAGCAGCAAGGGAATTAGGGGAGACTCGGATGATCGTGATGATGGATTACAATGTTTATTTAATGGGAATTGTCGTCAATGAAAATACATCCACA
GAGTCTCTAGGTAAACTTACTTGCCTAGACGATTCAGAACAAGTCAAGATATCTCAAGTCTTTCATTGTGACGGTTTATTGTTATGCATCTTGAAAGACGATGATACTAAGATTGTGGTT
TGGAATCCGTATTTGGGGCAAACAAGATGGATCCAAACCAGAAAGTATTACCGCGCTGGTGGCTGGAAAGGACGAGATATTTACATGTACGCTCTCGGATTCAAAAATAATAGCAAAAGC
AGATCTTGTCGCAGCCCCAAAATCTTGAGGTTTATAGATGATTTCAAACTTCGCCCCGAGAATCCCGCTTTACGGTATGAAATCTACGATTTTGATTCTGATTTATGGACCACTCTTGAT
GTCTCTCCACACTGGCGTATAATGTCTCAGCGTGGCCTTTCTATCAAGGGAAACACTTACTGGGGTGCTGTAGAACGGAATGAATACGCACCTATTAGTCATATAATCTGTTTTGATTTT
ACAAGAGAGAGATTTGGACCGCTTTTGCCTCTGCCATTTAGTGCTTGGGGTGCAGAGTTTGCGTCACTATCTTCGGTTAGAGAAGAGAAGATCGCTGCTTTATTTCAGACAAGCGAAACA
TTTAAGTTTGAGATATGGATTACAACTAAGATTGAGGCTGAAAATGTGTCGTGGAGCAGATTCTTCACAATGGATACATCATACCTTGACAGTAAGCTCTCATATAAGAGTTTCTTCATT
GACGAGGAGAAGAAAGTTGCTGTGGTTTTTGAAAAAGAAGGAAAAACAATATGCGACCTCACTCATGACACTATAAATATCATTGGAGAGGATGGATGCATAATGAAATTGGAGCTTGGA
GAACCCGCAGACAAAAACTGTTGGCCACTTGTGTGCTCTTATGTTCCAAGTGTAGTGCAAATCAAGCTACATAAAGGAGGCAAAAGGAAAGAACAAAGCGATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCCAATTGCTGTCGGCGATGTTGTACCTGACGGAACCATCTCTTTCGTCGATGACAATGATCAACTTCAGACCGCCTCCGTTCACTCTCTCGCCGCCGGTAAGAAAGTCATTCTC
TTTGGTGTCCCTGGTGCTTTCACTCCCACATGCAG
CATGAAGCATGTGCCTGGTTTCATTGAGAAAGCAGAGGAACTAAAATCAAATTATGTTGATGAGATCATTTGCTTTAGTGTGAAT
GACCCATTTGTGATGAAGGCATGGGGAAAGACATACGCTGAGAACAAGCATGTGAAGTTTGTAGCAGATGGGTCTGGAAAATACACACATCTTCTCGGACTTGAGCTTGACCTCAAAGAT
AAGGGTCATGGTGTTAGGTCAAAGAGTTTCGCTCTGTTAATCGATAACCTCAAGGTGATTGTAGCCAAAGTTGAATCTGGAG
ATTTGGTAGAGCGGATTGTCTCTATGGTTCCCTTGAAA
TTTATGAGATCAGTGCGATTAACTTGCAAAAGGTGGAACGGTTTGTTCAAAAGCCGGAGCTTTATGAAGATGCACATTGACAAAGAAGCAGCAGCAAGGGAATTAGGGGAGACTCGGATG
ATCGTGATGATGGATTACAATGTTTATTTAATGGGAATTGTCGTCAATGAAAATACATCCACAGAGTCTCTAGGTAAACTTACTTGCCTAGACGATTCAGAACAAGTCAAGATATCTCAA
GTCTTTCATTGTGACGGTTTATTGTTATGCATCTTGAAAGACGATGATACTAAGATTGTGGTTTGGAATCCGTATTTGGGGCAAACAAGATGGATCCAAACCAGAAAGTATTACCGCGCT
GGTGGCTGGAAAGGACGAGATATTTACATGTACGCTCTCGGATTCAAAAATAATAGCAAAAGCAGATCTTGTCGCAGCCCCAAAATCTTGAGGTTTATAGATGATTTCAAACTTCGCCCC
GAGAATCCCGCTTTACGGTATGAAATCTACGATTTTGATTCTGATTTATGGACCACTCTTGATGTCTCTCCACACTGGCGTATAATGTCTCAGCGTGGCCTTTCTATCAAGGGAAACACT
TACTGGGGTGCTGTAGAACGGAATGAATACGCACCTATTAGTCATATAATCTGTTTTGATTTTACAAGAGAGAGATTTGGACCGCTTTTGCCTCTGCCATTTAGTGCTTGGGGTGCAGAG
TTTGCGTCACTATCTTCGGTTAGAGAAGAGAAGATCGCTGCTTTATTTCAGACAAGCGAAACATTTAAGTTTGAGATATGGATTACAACTAAGATTGAGGCTGAAAATGTGTCGTGGAGC
AGATTCTTCACAATGGATACATCATACCTTGACAGTAAGCTCTCATATAAGAGTTTCTTCATTGACGAGGAGAAGAAAGTTGCTGTGGTTTTTGAAAAAGAAGGAAAAACAATATGCGAC
CTCACTCATGACACTATAAATATCATTGGAGAGGATGGATGCATAATGAAATTGGAGCTTGGAGAACCCGCAGACAAAAACTGTTGGCCACTTGTGTGCTCTTATGTTCCAAGTGTAGTG
CAAATCAAGCTACATAAAGGAGGCAAAAGGAAAGAACAAAGCGATTAG

Retrieve as FASTA