Entry information : AlyPrxIIA-3
Entry ID 7478
Creation 2010-08-10 (Christophe Dunand)
Last sequence changes 2010-08-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-05-10 (Christophe Dunand)
Peroxidase information: AlyPrxIIA-3
Name AlyPrxIIA-3
Class Atypical 2-Cysteine peroxiredoxin (type II)    [Orthogroup: PrxII003]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrxIIA-3
start..stop
S start..stop
AlyPrxIIA-2 561 0 10..389 147..534
AlyPrxIIA-4 550 0 1..389 1..395
AlyPrxIIA-1 521 0 4..385 2..386
AtPrxII01 526 0 2..392 156..550
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 20523523..20524687 1165 N° 2 20522934..20523133 200  
complement(join(20522934..20523133,20523523..20524687))


exon

Literature and cross-references AlyPrxIIA-3
DNA ref. Phytozome 11:   scaffold_6 (20524687..20522934)
Protein sequence: AlyPrxIIA-3
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   454
PWM (Da):   %s   52564.83  
PI (pH):   %s   7.75
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTTTMSNLPNDLLEEIVSRVPLKSMRKVRLTCKKWNALFKSRSFTKMHIGKEEEASKELGETRMIVMMDCNVYLMGIIVNENPSIESLGKLTCLHDSEQVKISQVFHCEGLLLCILKVDNTKIVVWNPYLGQTRWIQTGKHYHASGWVTLDVYNYALGYENNSENRSLKILRFTKDFHYHFPENVALWYEIYDFDTDLWTTLDVSPHWRIISNCGLSLKGNTYWGAVERNASAHHIICFDFTIGRFGPLLPLPFKARGSDFVPLSSVRDEKIAALFRASEKVEIWITTNIDDAKNVSWSKFVTLNIPYLDQNLSYKSFLIDEEKKVVVVFDNERKVTHNTIIIIGEAGCLRKLELGEPVDKNCWPLVCSYVPSIVQIKQHNEGQKKNQTSDYGYMVYSLHRFMIWKLVIHVMVSALKELNHYHGYESIPYHIKEMCFRITTLEDRDTRFGVLKK

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6, 1 intron)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGACGACGATGTCAAATCTTCCAAATGATTTGTTAGAAGAGATTGTCTCTAGGGTTCCTCTAAAATCTATGAGAAAAGTGAGATTAACATGCAAAAAATGGAATGCTTTGTTCAAA
AGCCGGAGTTTTACGAAGATGCATATTGGGAAAGAAGAAGAAGCATCAAAGGAATTAGGAGAGACTCGGATGATCGTGATGATGGATTGCAATGTTTATTTAATGGGCATCATCGTCAAT
GAAAATCCATCCATAGAGTCTTTAGGTAAACTTACTTGTCTACATGATTCAGAACAAGTCAAGATATCTCAAGTCTTTCATTGTGAGGGTTTATTACTATGCATCTTAAAAGTTGATAAT
ACTAAGATTGTGGTTTGGAATCCGTATCTGGGGCAAACAAGGTGGATCCAAACCGGAAAGCATTACCATGCAAGTGGATGGGTAACACTAGATGTTTACAATTACGCTCTCGGATACGAA
AATAATAGTGAAAATCGTAGCCTCAAAATCTTGAGGTTTACAAAAGATTTCCATTATCACTTTCCCGAAAACGTCGCTTTATGGTATGAAATCTATGATTTTGATACTGATTTATGGACT
ACTCTTGATGTCTCTCCACACTGGCGGATAATATCTAACTGTGGTCTTTCTCTCAAGGGAAACACTTACTGGGGCGCTGTAGAACGGAATGCATCCGCACATCATATAATTTGTTTTGAT
TTTACAATAGGGAGATTTGGACCGCTTCTACCTCTGCCGTTTAAGGCGAGGGGTTCAGATTTTGTGCCACTATCTTCGGTTAGAGATGAGAAGATCGCAGCTTTATTTCGGGCAAGCGAA
AAGGTTGAGATATGGATTACGACTAATATTGATGATGCCAAAAATGTGTCCTGGAGCAAGTTTGTTACACTAAATATACCATACCTTGACCAGAATCTTTCATATAAGAGTTTCCTCATT
GATGAAGAGAAGAAAGTTGTTGTGGTTTTTGATAACGAAAGAAAAGTCACGCACAACACCATTATTATCATTGGAGAGGCTGGATGCTTGAGGAAATTGGAGCTTGGAGAACCCGTAGAC
AAAAACTGTTGGCCACTTGTGTGCTCGTATGTTCCAAGTATAGTGCAAATCAAGCAACATAATGAAGGGCAAAAGAAAAACCAAA
GTGATTAGGAAAGGCGTCGACATCAATATGTTCAA
AACATGTTGAGACATGACAACAAATCAAGCAAGAGGAGGTGGCAAAAGGAAAAAACAATGGAAATTTGATTAGTCTCAATTTACAAAGTCTAGTTTATATGTCTTTCATTTTCCCGGTTT
TTTCTTTTAGCAATATTAGTTTGTTTCTTCCCATCTATTGTTCTATATGAAAAAAAAATGTTATGTTTTACTTTTTAATTCTTACAAAACCGCTAGGTGATCCATTAAATGACTAGTTTG
GTCAGAAATATCACATCCATCTCCGGAGGCGTGGTTAATACAAGTTGCAAGTATAGAAGAATATGTGTACTTGTCTCATACATTCATTTTGTACTTGATGAGATTGTGTTGCAGCTTCTG
ACTACGGGTATATGGTTTATTCCTTACATCGTTTCATGATTTGGAAGTTGGTTATACATGTTATGGTTTCTGCACTAAAAGAACTTAATCATTACCATGGATATGAGAGTATCCCATACC
ATATTAAAGAGATGTGTTTTAGGATTACAACTTTAGAAGATAGAGATACTCGATTTGGTGTCTTAAAAAAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGACGACGATGTCAAATCTTCCAAATGATTTGTTAGAAGAGATTGTCTCTAGGGTTCCTCTAAAATCTATGAGAAAAGTGAGATTAACATGCAAAAAATGGAATGCTTTGTTCAAA
AGCCGGAGTTTTACGAAGATGCATATTGGGAAAGAAGAAGAAGCATCAAAGGAATTAGGAGAGACTCGGATGATCGTGATGATGGATTGCAATGTTTATTTAATGGGCATCATCGTCAAT
GAAAATCCATCCATAGAGTCTTTAGGTAAACTTACTTGTCTACATGATTCAGAACAAGTCAAGATATCTCAAGTCTTTCATTGTGAGGGTTTATTACTATGCATCTTAAAAGTTGATAAT
ACTAAGATTGTGGTTTGGAATCCGTATCTGGGGCAAACAAGGTGGATCCAAACCGGAAAGCATTACCATGCAAGTGGATGGGTAACACTAGATGTTTACAATTACGCTCTCGGATACGAA
AATAATAGTGAAAATCGTAGCCTCAAAATCTTGAGGTTTACAAAAGATTTCCATTATCACTTTCCCGAAAACGTCGCTTTATGGTATGAAATCTATGATTTTGATACTGATTTATGGACT
ACTCTTGATGTCTCTCCACACTGGCGGATAATATCTAACTGTGGTCTTTCTCTCAAGGGAAACACTTACTGGGGCGCTGTAGAACGGAATGCATCCGCACATCATATAATTTGTTTTGAT
TTTACAATAGGGAGATTTGGACCGCTTCTACCTCTGCCGTTTAAGGCGAGGGGTTCAGATTTTGTGCCACTATCTTCGGTTAGAGATGAGAAGATCGCAGCTTTATTTCGGGCAAGCGAA
AAGGTTGAGATATGGATTACGACTAATATTGATGATGCCAAAAATGTGTCCTGGAGCAAGTTTGTTACACTAAATATACCATACCTTGACCAGAATCTTTCATATAAGAGTTTCCTCATT
GATGAAGAGAAGAAAGTTGTTGTGGTTTTTGATAACGAAAGAAAAGTCACGCACAACACCATTATTATCATTGGAGAGGCTGGATGCTTGAGGAAATTGGAGCTTGGAGAACCCGTAGAC
AAAAACTGTTGGCCACTTGTGTGCTCGTATGTTCCAAGTATAGTGCAAATCAAGCAACATAATGAAGGGCAAAAGAAAAACCAAA
CTTCTGACTACGGGTATATGGTTTATTCCTTACAT
CGTTTCATGATTTGGAAGTTGGTTATACATGTTATGGTTTCTGCACTAAAAGAACTTAATCATTACCATGGATATGAGAGTATCCCATACCATATTAAAGAGATGTGTTTTAGGATTACA
ACTTTAGAAGATAGAGATACTCGATTTGGTGTCTTAAAAAAGTAA

Retrieve as FASTA