Entry information : AlyPrx10
Entry ID 7479
Creation 2010-08-10 (Christophe Dunand)
Last sequence changes 2010-08-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyPrx10
Name AlyPrx10
Class Class III peroxidase    [Orthogroup: Prx021]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx10
start..stop
S start..stop
AhalPrx15 707 0 1..350 1..350
AtPrx10 701 0 1..350 1..350
BstrPrx66 671 0 1..350 1..350
CagraPrx12 645 0 1..350 1..356
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 25736890..25737168 279 N° 2 25737552..25737743 192 N° 3 25737858..25738023 166 N° 4 25738223..25738638 416
join(25736890..25737168,25737552..25737743,25737858..25738023,25738223..25738638 )


exon

Literature and cross-references AlyPrx10
DNA ref. Phytozome 12:   scaffold_1 (25736890..25738638)
Protein sequence: AlyPrx10
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   350
PWM (Da):   %s   37979.04 Transmb domain:   %s   i7-29o
PI (pH):   %s   6.77
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDHKISMYLFVSYLAVFTLFFKGFVSSFPSGYNNGYNNGHGYGLTSNLNYRFYDRSCPRLQTIVKSGVWRAFKDDSRIAASLLRLHFHDCFVNGCDGSILLNDSEDFKGEKNARPNRNSVRGFEVIEDIKSDIESSCPLTVSCADIVALAAREAVVLTGGPFWPVPLGRRDSLTASEQAANTNLPSPLEPLENITAKFVTLGLDLKDVVVLSGAHTIGFAQCFVFKHRLFNFKGSGQPDPNLAASSALLSKLKDTCPNVDSSDSKLAALDAASSVKFDNAYYVNLVNNIGLLDSDQTLMTDPTAAALVKSYSENPYLFSKDFVVSMVKMGNIGVMTGSDGVIRAKCGFPG

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 3 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACCACAAAATCTCAATGTATTTGTTTGTGTCTTACCTAGCAGTCTTTACTCTTTTCTTCAAAGGCTTTGTCTCCTCGTTTCCTTCGGGATATAACAATGGTTACAATAATGGTCAC
GGATATGGACTAACTAGCAATCTCAACTATCGATTCTATGACCGGTCTTGTCCTCGTCTTCAGACGATTGTTAAGTCCGGAGTTTGGAGAGCTTTTAAAGATGATTCTAGAATCGCTGCG
TCTCTTCTTCGACTCCATTTCCACGATTGTTTTGTCAAT
GTAAGTTTGTTTAATTGTTATTGTAAGTTACGTGACATTTTCTTTTTATATTTACGGATGCATATATAAGATTGTGGATTA
TATATCACTCACTGTATACACATATATATCACTAGTCAAACATACTTTATACGTATTAACATTTAAGCCGTGTATATATTAAAAAAATAATCACTCAAATTCTACAAAACTTAAAACATT
CTTTATTTAGACATACATATATATACATAATACATCAACAATTTTTGTATGTTTTAGTATATAAAAGATACATATTAGAGTCTAGTCACTAGACTAAAGGCTCTATATATATATGTGTGT
ATCAAATATCTAATATTTCCTATATAATTAGGAAATAAAAGTGATTAAATTGTATGTTGTAGGGATGTGATGGATCTATACTTCTGAACGATTCCGAGGATTTCAAAGGAGAGAAGAACG
CTCGGCCAAACCGAAACTCAGTCCGTGGCTTCGAAGTCATTGAAGACATTAAATCTGATATCGAAAGCTCTTGTCCCTTAACAGTTTCATGCGCTGACATAGTTGCTCTGGCAGCTAGAG
AAGCCGTCGTCCTT
GTACGTGTGATCTTAAAACCCTTAAATTATTGATTTGAAATGTGAAAATATTATGATGAAAAAAACAAAACATAATCGATCGGTTCATTACTTATGACTTCTCATG
CCATGTAGACTGGAGGGCCGTTTTGGCCCGTGCCTTTGGGACGAAGGGACTCATTAACGGCGAGTGAGCAAGCGGCGAATACAAATCTGCCATCTCCGTTGGAGCCGTTGGAGAATATAA
CGGCCAAGTTCGTGACCCTTGGACTCGACCTCAAGGATGTTGTTGTCCTCTCAG
GTTTGGTCACTTCAACTAACAATAAACCATAGATATATGAATAATAATATCGATTGACTTTTGTAT
TAATTAGCCAAAATATGTTTTAAAAATGAGGTAGCAAATCGATTATTATAAACAAAATTAAATAGAGTAAAGTACTTCATTAGGCATGTATATACATGAACTTATGCTACTATATGACTA
TACGTGTATGTAGGAGCACACACTATAGGATTTGCTCAATGTTTCGTGTTCAAGCACAGGCTCTTCAACTTCAAGGGCTCAGGCCAGCCTGACCCAAACCTAGCTGCTTCATCGGCTCTT
CTCTCTAAGCTAAAGGACACATGTCCTAATGTGGACTCTTCGGACTCTAAGCTCGCAGCTCTTGACGCAGCTAGCTCAGTCAAGTTTGACAATGCTTACTACGTGAACTTAGTGAACAAC
ATAGGACTGTTGGATTCCGATCAAACCCTAATGACGGATCCTACGGCTGCCGCCTTGGTGAAGTCGTACAGCGAGAATCCATACTTGTTCTCGAAGGATTTCGTAGTTTCAATGGTTAAA
ATGGGGAATATCGGAGTTATGACAGGAAGTGATGGAGTCATTCGAGCAAAATGTGGATTTCCAGGTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACCACAAAATCTCAATGTATTTGTTTGTGTCTTACCTAGCAGTCTTTACTCTTTTCTTCAAAGGCTTTGTCTCCTCGTTTCCTTCGGGATATAACAATGGTTACAATAATGGTCAC
GGATATGGACTAACTAGCAATCTCAACTATCGATTCTATGACCGGTCTTGTCCTCGTCTTCAGACGATTGTTAAGTCCGGAGTTTGGAGAGCTTTTAAAGATGATTCTAGAATCGCTGCG
TCTCTTCTTCGACTCCATTTCCACGATTGTTTTGTCAAT
GGATGTGATGGATCTATACTTCTGAACGATTCCGAGGATTTCAAAGGAGAGAAGAACGCTCGGCCAAACCGAAACTCAGTC
CGTGGCTTCGAAGTCATTGAAGACATTAAATCTGATATCGAAAGCTCTTGTCCCTTAACAGTTTCATGCGCTGACATAGTTGCTCTGGCAGCTAGAGAAGCCGTCGTCCTT
ACTGGAGGG
CCGTTTTGGCCCGTGCCTTTGGGACGAAGGGACTCATTAACGGCGAGTGAGCAAGCGGCGAATACAAATCTGCCATCTCCGTTGGAGCCGTTGGAGAATATAACGGCCAAGTTCGTGACC
CTTGGACTCGACCTCAAGGATGTTGTTGTCCTCTCAG
GAGCACACACTATAGGATTTGCTCAATGTTTCGTGTTCAAGCACAGGCTCTTCAACTTCAAGGGCTCAGGCCAGCCTGACCCA
AACCTAGCTGCTTCATCGGCTCTTCTCTCTAAGCTAAAGGACACATGTCCTAATGTGGACTCTTCGGACTCTAAGCTCGCAGCTCTTGACGCAGCTAGCTCAGTCAAGTTTGACAATGCT
TACTACGTGAACTTAGTGAACAACATAGGACTGTTGGATTCCGATCAAACCCTAATGACGGATCCTACGGCTGCCGCCTTGGTGAAGTCGTACAGCGAGAATCCATACTTGTTCTCGAAG
GATTTCGTAGTTTCAATGGTTAAAATGGGGAATATCGGAGTTATGACAGGAAGTGATGGAGTCATTCGAGCAAAATGTGGATTTCCAGGTTAA

Retrieve as FASTA